Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Clcn1'

574656

Institutional Source

Beutler Lab

Gene Symbol

Clcn1

Ensembl Gene

ENSMUSG00000029862

Gene Name

chloride channel, voltage-sensitive 1

Synonyms

Clc1, SMCC1, nmf355, NMF355, Clc-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7225 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42286685-42315756 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 42293462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 232 (D232N)

Ref Sequence

ENSEMBL: ENSMUSP00000126045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]

AlphaFold

Q64347

Predicted Effect

probably benign
Transcript: ENSMUST00000031894

SMART Domains

Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	572	3.2e-87	PFAM
Blast:CBS	612	662	1e-24	BLAST
low complexity region	723	747	N/A	INTRINSIC
Blast:CBS	830	877	4e-19	BLAST
low complexity region	928	950	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163936

SMART Domains

Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	1.2e-27	PFAM
Pfam:Voltage_CLC	258	501	3.9e-44	PFAM
PDB:2D4Z\|B	520	807	2e-47	PDB
Blast:CBS	541	591	2e-24	BLAST
Blast:CBS	759	806	3e-19	BLAST
low complexity region	857	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164091

SMART Domains

Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	256	2.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165780

SMART Domains

Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	227	9.7e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168660
AA Change: D232N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862
AA Change: D232N

Domain	Start	End	E-Value	Type
low complexity region	88	97	N/A	INTRINSIC
Pfam:Voltage_CLC	136	257	1.1e-22	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862
AA Change: D235N

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	2.9e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170028

SMART Domains

Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	235	8e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cluh	T	G	11: 74,666,406		probably null	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Clcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Clcn1	APN	6	42291703	missense	probably damaging	1.00
IGL01732:Clcn1	APN	6	42310672	splice site	probably benign
IGL02055:Clcn1	APN	6	42307555	missense	probably damaging	1.00
IGL02507:Clcn1	APN	6	42307073	splice site	probably benign
IGL02649:Clcn1	APN	6	42298829	missense	probably damaging	1.00
IGL02739:Clcn1	APN	6	42286780	splice site	probably null
IGL03148:Clcn1	APN	6	42299991	critical splice donor site	probably null
IGL03190:Clcn1	APN	6	42290103	missense	probably benign	0.02
IGL03327:Clcn1	APN	6	42311219	missense	probably benign	0.00
IGL03346:Clcn1	APN	6	42311219	missense	probably benign	0.00
Faint	UTSW	6	42307265	missense	probably damaging	1.00
jack_spratt	UTSW	6	42310581	missense	probably benign
Limitations	UTSW	6	42310063	missense	possibly damaging	0.79
maimed	UTSW	6	42298820	missense	probably damaging	1.00
stunted	UTSW	6	42286767	start codon destroyed	possibly damaging	0.79
R0167:Clcn1	UTSW	6	42286836	missense	probably damaging	1.00
R0323:Clcn1	UTSW	6	42310140	missense	probably damaging	0.99
R0491:Clcn1	UTSW	6	42310581	missense	probably benign
R0573:Clcn1	UTSW	6	42313045	splice site	probably null
R0615:Clcn1	UTSW	6	42305575	missense	probably damaging	1.00
R0944:Clcn1	UTSW	6	42313141	missense	probably benign	0.00
R1562:Clcn1	UTSW	6	42300235	missense	probably benign	0.29
R1566:Clcn1	UTSW	6	42291440	missense	possibly damaging	0.58
R1692:Clcn1	UTSW	6	42313098	missense	possibly damaging	0.67
R1728:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1729:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1772:Clcn1	UTSW	6	42294145	missense	probably damaging	1.00
R1784:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1793:Clcn1	UTSW	6	42298926	critical splice donor site	probably null
R1861:Clcn1	UTSW	6	42313991	missense	possibly damaging	0.63
R1864:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R1865:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R2356:Clcn1	UTSW	6	42291625	missense	probably damaging	1.00
R2403:Clcn1	UTSW	6	42313112	missense	probably damaging	0.99
R2987:Clcn1	UTSW	6	42298850	missense	probably damaging	1.00
R3082:Clcn1	UTSW	6	42290178	missense	probably damaging	0.98
R3500:Clcn1	UTSW	6	42292995	missense	probably damaging	0.99
R3747:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R3748:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R4041:Clcn1	UTSW	6	42309968	missense	probably damaging	1.00
R4749:Clcn1	UTSW	6	42290197	splice site	probably null
R4836:Clcn1	UTSW	6	42309964	missense	probably damaging	0.96
R5021:Clcn1	UTSW	6	42310988	nonsense	probably null
R5085:Clcn1	UTSW	6	42313880	missense	probably benign	0.41
R5528:Clcn1	UTSW	6	42300341	missense	probably benign	0.01
R5628:Clcn1	UTSW	6	42298889	missense	probably damaging	0.96
R5678:Clcn1	UTSW	6	42307265	missense	probably damaging	1.00
R5943:Clcn1	UTSW	6	42292966	missense	probably damaging	1.00
R6053:Clcn1	UTSW	6	42300274	nonsense	probably null
R6175:Clcn1	UTSW	6	42314162	missense	probably damaging	1.00
R6394:Clcn1	UTSW	6	42307590	missense	possibly damaging	0.84
R6394:Clcn1	UTSW	6	42313238	missense	possibly damaging	0.82
R7012:Clcn1	UTSW	6	42290608	missense	probably benign	0.01
R7020:Clcn1	UTSW	6	42298820	missense	probably damaging	1.00
R7048:Clcn1	UTSW	6	42307543	missense	probably damaging	1.00
R7212:Clcn1	UTSW	6	42291389	missense	possibly damaging	0.46
R7264:Clcn1	UTSW	6	42298838	missense	probably damaging	1.00
R7636:Clcn1	UTSW	6	42291334	nonsense	probably null
R7663:Clcn1	UTSW	6	42310063	missense	possibly damaging	0.79
R7807:Clcn1	UTSW	6	42310348	splice site	probably null
R7954:Clcn1	UTSW	6	42286691	unclassified	probably benign
R8026:Clcn1	UTSW	6	42307661	critical splice donor site	probably null
R8045:Clcn1	UTSW	6	42290694	missense	probably damaging	1.00
R8499:Clcn1	UTSW	6	42307199	missense	probably damaging	1.00
R8523:Clcn1	UTSW	6	42307589	nonsense	probably null
R8677:Clcn1	UTSW	6	42290585	critical splice acceptor site	probably null
R8818:Clcn1	UTSW	6	42305543	missense	probably damaging	0.98
R8945:Clcn1	UTSW	6	42286767	start codon destroyed	possibly damaging	0.79
R9012:Clcn1	UTSW	6	42291633	missense	possibly damaging	0.75
R9295:Clcn1	UTSW	6	42313949	missense	probably benign	0.00
R9433:Clcn1	UTSW	6	42305560	missense	probably damaging	1.00
Z1088:Clcn1	UTSW	6	42300360	missense	probably benign	0.40
Z1088:Clcn1	UTSW	6	42307256	missense	probably damaging	1.00
Z1176:Clcn1	UTSW	6	42307567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTTCCTACCCACATGAACTG -3'
(R):5'- AAACATATGGGTCCCTGGAGC -3'

Sequencing Primer
(F):5'- ATGAACTGTGTCGATTCCTTTCCATG -3'
(R):5'- AGGTGTGGCAATCCAGTCACTC -3'

Posted On

2019-09-27