Mutagenetix > Incidental Mutations

Incidental Mutation 'R7225:Cluh'

574657

Institutional Source

Beutler Lab

Gene Symbol

Cluh

Ensembl Gene

ENSMUSG00000020741

Gene Name

clustered mitochondria (cluA/CLU1) homolog

Synonyms

1300001I01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.246) question?

Stock #

R7225 (G1)

Quality Score

111.008

Status

Validated

Chromosome

Chromosomal Location

74649495-74670847 bp(+) (GRCm38)

Type of Mutation

splice site (112 bp from exon)

DNA Base Change (assembly)

T to G at 74666406 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000092915

SMART Domains

Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741

Domain	Start	End	E-Value	Type
Pfam:CLU_N	104	177	3.1e-28	PFAM
Pfam:CLU	394	614	3.4e-89	PFAM
Pfam:eIF3_p135	806	988	1.3e-58	PFAM
Pfam:TPR_10	1059	1100	2.9e-7	PFAM
low complexity region	1114	1125	N/A	INTRINSIC
Pfam:TPR_12	1140	1218	1.7e-10	PFAM
low complexity region	1316	1334	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117818

SMART Domains

Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741

Domain	Start	End	E-Value	Type
Pfam:CLU_N	102	177	9.8e-30	PFAM
Pfam:CLU	394	615	5.3e-92	PFAM
Pfam:eIF3_p135	796	938	2.9e-38	PFAM
Pfam:TPR_10	1008	1049	9.5e-7	PFAM
low complexity region	1063	1074	N/A	INTRINSIC
Pfam:TPR_12	1089	1167	1.1e-9	PFAM
low complexity region	1265	1283	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (62/63)

MGI Phenotype

PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	T	C	12: 110,670,865		probably benign	Het
5430403G16Rik	T	C	5: 109,677,149	H145R	possibly damaging	Het
5730480H06Rik	T	A	5: 48,380,233		probably null	Het
Actn4	A	T	7: 28,898,699	V492D	probably damaging	Het
Alpk2	T	C	18: 65,305,199	E1041G	probably benign	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Cd22	C	T	7: 30,877,634	A83T	not run	Het
Cdan1	T	C	2: 120,724,912	T783A	probably benign	Het
Cdh9	C	T	15: 16,856,073	S733F	probably damaging	Het
Cfap54	A	G	10: 92,904,374	F2282S	unknown	Het
Chst9	T	C	18: 15,452,661	K282E	probably damaging	Het
Clcn1	G	A	6: 42,293,462	D232N	probably damaging	Het
Clpb	T	A	7: 101,711,465	L234Q	probably damaging	Het
Cnp	C	T	11: 100,580,587	Q352*	probably null	Het
Cyfip1	AGTGT	AGT	7: 55,928,189		probably null	Het
Dtx3	C	T	10: 127,191,489	C272Y	probably damaging	Het
Dync2h1	A	G	9: 7,142,756	I1156T	probably benign	Het
Epg5	T	A	18: 78,012,702	V1697E	probably benign	Het
Exoc3l4	A	G	12: 111,423,624	D211G	probably benign	Het
Fank1	A	G	7: 133,853,259	K36R	probably benign	Het
Fat4	T	C	3: 38,980,176	I2659T	possibly damaging	Het
Fer1l5	T	C	1: 36,420,952	W1893R	possibly damaging	Het
Gorasp2	T	A	2: 70,684,047	L256Q	probably damaging	Het
Gpc5	T	G	14: 115,552,298	V528G	probably damaging	Het
Gria2	T	A	3: 80,802,631		probably benign	Het
Htatip2	A	G	7: 49,770,856	E150G	possibly damaging	Het
Jak3	C	A	8: 71,685,511	Q869K	probably benign	Het
Jmjd1c	T	C	10: 67,226,065	V1218A	probably benign	Het
Kcnf1	A	G	12: 17,175,693	C176R	possibly damaging	Het
Kcnq4	A	G	4: 120,746,914	V88A	probably benign	Het
Lmod3	T	A	6: 97,247,384	D492V	probably benign	Het
Lurap1l	A	C	4: 80,911,481	S43R	probably benign	Het
Mamdc4	T	C	2: 25,565,546	H890R	possibly damaging	Het
Mertk	T	G	2: 128,801,562	N960K	possibly damaging	Het
Nudt9	C	A	5: 104,065,100	D346E	probably benign	Het
Olfr1434	A	T	19: 12,283,467	T140S	probably benign	Het
Opa1	A	G	16: 29,614,039		probably null	Het
Oxr1	C	T	15: 41,813,608	P187L	not run	Het
Paxbp1	T	C	16: 91,027,068	E564G	probably damaging	Het
Pcdhb13	C	T	18: 37,444,437	R623C	possibly damaging	Het
Pkhd1l1	G	T	15: 44,546,941	V2615F	probably damaging	Het
Plin3	T	C	17: 56,286,541	T58A	possibly damaging	Het
Por	A	G	5: 135,732,587	D309G	probably benign	Het
Ppp2r5e	T	C	12: 75,468,579	K261R	probably damaging	Het
Ptpn18	C	T	1: 34,472,846	T366I	possibly damaging	Het
Ptprz1	G	A	6: 23,000,929	G1006E	possibly damaging	Het
Rnf219	T	C	14: 104,479,858	T360A	probably benign	Het
Rpl12	C	T	2: 32,961,897		probably benign	Het
Rpsa	T	G	9: 120,131,156	F262V	probably benign	Het
Sh3pxd2a	G	T	19: 47,267,389	N991K	probably damaging	Het
Shank2	T	A	7: 144,285,025	N19K	probably benign	Het
Sik1	T	C	17: 31,854,300	T61A	probably benign	Het
Sipa1l3	A	C	7: 29,399,428	V472G	probably damaging	Het
Sirt6	A	G	10: 81,622,481	S313P	probably benign	Het
Slc12a7	A	G	13: 73,763,962		probably benign	Het
Sox13	A	T	1: 133,387,124	V266E	probably benign	Het
Spag9	T	C	11: 94,097,358	C833R	probably damaging	Het
Tcof1	T	C	18: 60,828,448	T812A	unknown	Het
Tnfsf4	A	G	1: 161,417,250	D170G	possibly damaging	Het
Tshz3	A	G	7: 36,769,657	N357S	probably damaging	Het
Txk	C	T	5: 72,700,714	D418N	probably damaging	Het
Ube2j2	A	G	4: 155,949,316		probably null	Het
Vmn2r84	G	A	10: 130,386,683	P556L	probably damaging	Het
Zfp442	T	C	2: 150,409,005	N326D	probably benign	Het

Other mutations in Cluh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cluh	APN	11	74664064	missense	probably benign	0.28
IGL00858:Cluh	APN	11	74659605	missense	possibly damaging	0.86
IGL01380:Cluh	APN	11	74665946	missense	probably benign	0.04
IGL02402:Cluh	APN	11	74657171	missense	probably damaging	1.00
IGL02620:Cluh	APN	11	74665067	nonsense	probably null
IGL02990:Cluh	APN	11	74667765	splice site	probably null
IGL03163:Cluh	APN	11	74666068	missense	probably benign	0.44
IGL03208:Cluh	APN	11	74669506	splice site	probably null
IGL03293:Cluh	APN	11	74665752	missense	probably benign	0.03
IGL03408:Cluh	APN	11	74665953	missense	probably benign	0.06
spent	UTSW	11	74660372	missense	probably damaging	1.00
FR4342:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4342:Cluh	UTSW	11	74669526	small insertion	probably benign
FR4449:Cluh	UTSW	11	74669532	small insertion	probably benign
FR4589:Cluh	UTSW	11	74669531	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669514	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669519	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669533	small insertion	probably benign
FR4976:Cluh	UTSW	11	74669520	small insertion	probably benign
R0147:Cluh	UTSW	11	74665938	missense	probably damaging	1.00
R0153:Cluh	UTSW	11	74657350	splice site	probably benign
R0506:Cluh	UTSW	11	74664894	missense	probably benign	0.20
R0526:Cluh	UTSW	11	74665986	missense	probably benign	0.05
R0834:Cluh	UTSW	11	74663805	missense	probably benign	0.02
R1873:Cluh	UTSW	11	74662076	missense	possibly damaging	0.72
R1991:Cluh	UTSW	11	74659529	nonsense	probably null
R1992:Cluh	UTSW	11	74660002	missense	probably damaging	1.00
R2095:Cluh	UTSW	11	74661724	nonsense	probably null
R2101:Cluh	UTSW	11	74660502	splice site	probably benign
R2103:Cluh	UTSW	11	74659529	nonsense	probably null
R2220:Cluh	UTSW	11	74667121	missense	probably damaging	1.00
R3702:Cluh	UTSW	11	74665356	missense	probably benign
R3853:Cluh	UTSW	11	74656453	missense	probably benign	0.00
R3900:Cluh	UTSW	11	74667104	missense	probably benign	0.29
R4891:Cluh	UTSW	11	74665059	missense	possibly damaging	0.51
R4895:Cluh	UTSW	11	74667405	missense	probably damaging	1.00
R5056:Cluh	UTSW	11	74661946	missense	probably damaging	1.00
R5089:Cluh	UTSW	11	74660372	missense	probably damaging	1.00
R5217:Cluh	UTSW	11	74659705	missense	probably damaging	1.00
R5346:Cluh	UTSW	11	74665218	missense	probably damaging	1.00
R5382:Cluh	UTSW	11	74665109	intron	probably benign
R5516:Cluh	UTSW	11	74660444	missense	probably damaging	1.00
R5809:Cluh	UTSW	11	74661700	missense	probably damaging	1.00
R6146:Cluh	UTSW	11	74667228	splice site	probably null
R6326:Cluh	UTSW	11	74666242	missense	probably benign	0.10
R6541:Cluh	UTSW	11	74657214	missense	probably damaging	1.00
R6674:Cluh	UTSW	11	74666227	missense	probably damaging	1.00
R6870:Cluh	UTSW	11	74665384	missense	probably damaging	1.00
R6875:Cluh	UTSW	11	74661918	missense	probably damaging	1.00
R7086:Cluh	UTSW	11	74667340	missense	possibly damaging	0.46
R7310:Cluh	UTSW	11	74669459	missense	probably benign	0.10
R7317:Cluh	UTSW	11	74665704	missense	possibly damaging	0.90
R7674:Cluh	UTSW	11	74667720	missense	probably damaging	1.00
R7941:Cluh	UTSW	11	74659757	missense	probably benign	0.00
R9061:Cluh	UTSW	11	74660366	missense	possibly damaging	0.73
R9326:Cluh	UTSW	11	74664076	missense	probably benign	0.00
RF020:Cluh	UTSW	11	74669538	small insertion	probably benign
RF032:Cluh	UTSW	11	74669515	small insertion	probably benign
X0028:Cluh	UTSW	11	74663466	missense	probably benign	0.26
Z1177:Cluh	UTSW	11	74667754	missense	possibly damaging	0.82
Z1186:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1186:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669516	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669520	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669521	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669524	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1188:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669514	frame shift	probably null
Z1189:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669519	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669530	nonsense	probably null
Z1189:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669518	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669532	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669526	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669525	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCAACGAGGCTCTGAACC -3'
(R):5'- CATGGTCACTCAAAGGCCAG -3'

Sequencing Primer
(F):5'- GTTCAACAATGTCTACGGAGCCATG -3'
(R):5'- CACTCAAAGGCCAGGTATTGTGTC -3'

Posted On

2019-09-27