Incidental Mutation 'R7225:Slc12a7'
ID574658
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Namesolute carrier family 12, member 7
SynonymsKcc4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7225 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73733094-73816754 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 73763962 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900] [ENSMUST00000220535]
AlphaFold Q9WVL3
Predicted Effect probably benign
Transcript: ENSMUST00000017900
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000220535
AA Change: T66A
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Ube2j2 A G 4: 155,949,316 probably null Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3023:Slc12a7 UTSW 13 73800422 missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73785139 missense probably benign
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73793940 missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73798969 missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7534:Slc12a7 UTSW 13 73764068 intron probably benign
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
R7737:Slc12a7 UTSW 13 73788677 missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73805469 missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8019:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8281:Slc12a7 UTSW 13 73790677 missense probably damaging 1.00
R8342:Slc12a7 UTSW 13 73785162 missense probably benign
R8747:Slc12a7 UTSW 13 73785122 missense probably benign 0.30
R8920:Slc12a7 UTSW 13 73798449 missense probably damaging 1.00
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATGCCCACGAACTTTACG -3'
(R):5'- CCAACAGGGAGATATGCAGC -3'

Sequencing Primer
(F):5'- CACGAACTTTACGGTGGTGC -3'
(R):5'- GCGCCTCAAGCAAGGAG -3'
Posted On2019-09-27