Incidental Mutation 'R7239:Meis2'
ID574661
Institutional Source Beutler Lab
Gene Symbol Meis2
Ensembl Gene ENSMUSG00000027210
Gene NameMeis homeobox 2
SynonymsStra10, Meis2, A430109D20Rik, Mrg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R7239 (G1)
Quality Score116.008
Status Validated
Chromosome2
Chromosomal Location115863064-116065839 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 116059003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028639] [ENSMUST00000074285] [ENSMUST00000102538] [ENSMUST00000110906] [ENSMUST00000110907] [ENSMUST00000110908]
Predicted Effect probably null
Transcript: ENSMUST00000028639
SMART Domains Protein: ENSMUSP00000028639
Gene: ENSMUSG00000027210

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 110 194 3.8e-48 PFAM
HOX 276 341 4.27e-12 SMART
low complexity region 395 402 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074285
SMART Domains Protein: ENSMUSP00000073898
Gene: ENSMUSG00000027210

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 375 388 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102538
SMART Domains Protein: ENSMUSP00000099597
Gene: ENSMUSG00000027210

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 388 395 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110906
SMART Domains Protein: ENSMUSP00000106531
Gene: ENSMUSG00000027210

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 382 395 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110907
SMART Domains Protein: ENSMUSP00000106532
Gene: ENSMUSG00000027210

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110908
SMART Domains Protein: ENSMUSP00000106533
Gene: ENSMUSG00000027210

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 376 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele display early fetal lethality with hemorrhaging, persistent truncus arteriosis, absence of cardic valves and defects in other neural crest cell derived tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Psd2 G A 18: 35,980,419 A315T probably damaging Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Meis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Meis2 APN 2 115868793 missense probably damaging 1.00
IGL00708:Meis2 APN 2 115864244 missense probably benign 0.11
IGL01095:Meis2 APN 2 115864424 missense probably benign
IGL02199:Meis2 APN 2 116000256 missense probably benign 0.01
IGL02562:Meis2 APN 2 116049146 missense probably damaging 1.00
IGL02902:Meis2 APN 2 116063323 missense probably damaging 0.96
IGL03183:Meis2 APN 2 116059521 missense probably damaging 0.98
IGL03205:Meis2 APN 2 115864250 missense probably benign 0.08
P4748:Meis2 UTSW 2 115864480 missense probably benign 0.03
R0369:Meis2 UTSW 2 116063416 missense possibly damaging 0.82
R0410:Meis2 UTSW 2 115864228 makesense probably null
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1548:Meis2 UTSW 2 116058702 missense probably damaging 0.97
R1593:Meis2 UTSW 2 116000264 missense probably damaging 1.00
R3835:Meis2 UTSW 2 115921747 missense probably damaging 1.00
R4353:Meis2 UTSW 2 116059563 missense probably damaging 0.99
R4756:Meis2 UTSW 2 116000205 missense probably damaging 1.00
R4936:Meis2 UTSW 2 115864412 missense probably benign
R5841:Meis2 UTSW 2 116058664 missense probably benign
R5967:Meis2 UTSW 2 115864309 missense probably benign 0.04
R6661:Meis2 UTSW 2 115864270 missense probably damaging 0.97
R6781:Meis2 UTSW 2 116049155 missense probably benign 0.20
R7606:Meis2 UTSW 2 116063320 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTCAGCTCAGGTTGTCTTTATAG -3'
(R):5'- TTATCGTGGACCCAGTGCTC -3'

Sequencing Primer
(F):5'- CAGCTCAGGTTGTCTTTATAGGTTTC -3'
(R):5'- TGGACCCAGTGCTCTTGCTAG -3'
Posted On2019-09-27