Incidental Mutation 'R7239:Adamts7'
ID574662
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
SynonymsADAM-TS7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7239 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location90163069-90208071 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 90186557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
Predicted Effect probably null
Transcript: ENSMUST00000113059
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113060
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134996
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000147250
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167122
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Psd2 G A 18: 35,980,419 A315T probably damaging Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
PIT4495001:Adamts7 UTSW 9 90174622 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90188798 splice site probably benign
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2202:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90194010 missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4661:Adamts7 UTSW 9 90193330 missense probably benign 0.02
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90188694 missense probably benign 0.20
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 intron probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
R6947:Adamts7 UTSW 9 90191804 intron probably null
R7110:Adamts7 UTSW 9 90193964 missense possibly damaging 0.92
R7224:Adamts7 UTSW 9 90185815 missense probably damaging 1.00
R7519:Adamts7 UTSW 9 90197079 missense probably benign 0.22
R7608:Adamts7 UTSW 9 90173773 missense possibly damaging 0.68
R7635:Adamts7 UTSW 9 90195245 missense probably damaging 1.00
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGTTTGCACACTCACAGGATG -3'
(R):5'- CTGGGCCAGGATGTGAATTG -3'

Sequencing Primer
(F):5'- ACACTCACAGGATGGGCTGTC -3'
(R):5'- CCAGGATGTGAATTGGAATGGC -3'
Posted On2019-09-27