Incidental Mutation 'R7243:Lrba'
ID574688
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene NameLPS-responsive beige-like anchor
SynonymsLba, D3Ertd775e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7243 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location86224680-86782692 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 86751516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000194759] [ENSMUST00000195524] [ENSMUST00000195524]
Predicted Effect probably null
Transcript: ENSMUST00000107635
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107635
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192145
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194759
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194759
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195524
SMART Domains Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
Pfam:PH_BEACH 3 76 3.6e-20 PFAM
Beach 107 384 2.87e-207 SMART
WD40 482 519 7.4e0 SMART
WD40 522 565 1.72e0 SMART
WD40 581 620 3.99e-1 SMART
WD40 664 702 1.79e-1 SMART
WD40 705 744 4.28e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195524
SMART Domains Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
Pfam:PH_BEACH 3 76 3.6e-20 PFAM
Beach 107 384 2.87e-207 SMART
WD40 482 519 7.4e0 SMART
WD40 522 565 1.72e0 SMART
WD40 581 620 3.99e-1 SMART
WD40 664 702 1.79e-1 SMART
WD40 705 744 4.28e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Aox3 G T 1: 58,138,307 G227V unknown Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Grin2d A G 7: 45,866,128 L147P probably damaging Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Lrig2 A T 3: 104,497,567 probably null Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Odc1 T G 12: 17,550,057 Y407* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr561 A T 7: 102,781,658 T61S probably benign Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Ptprj T C 2: 90,446,421 H1102R probably damaging Het
Rbfox3 T C 11: 118,513,274 Y33C probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Rpgrip1l T C 8: 91,270,123 I710V probably benign Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86359782 missense probably benign 0.00
IGL00788:Lrba APN 3 86327685 missense probably damaging 0.97
IGL01139:Lrba APN 3 86642662 missense possibly damaging 0.88
IGL01302:Lrba APN 3 86295400 missense probably damaging 1.00
IGL01612:Lrba APN 3 86776177 missense possibly damaging 0.89
IGL01718:Lrba APN 3 86351248 missense probably damaging 1.00
IGL01719:Lrba APN 3 86327596 splice site probably benign
IGL01730:Lrba APN 3 86741424 missense possibly damaging 0.89
IGL01735:Lrba APN 3 86327661 missense probably benign 0.28
IGL01875:Lrba APN 3 86310047 missense probably damaging 1.00
IGL01884:Lrba APN 3 86310412 missense possibly damaging 0.86
IGL02264:Lrba APN 3 86780262 missense probably damaging 0.99
IGL02638:Lrba APN 3 86325073 missense probably damaging 0.97
IGL02647:Lrba APN 3 86359731 missense probably benign 0.00
IGL02664:Lrba APN 3 86325731 missense possibly damaging 0.84
IGL02728:Lrba APN 3 86776049 missense probably damaging 0.99
IGL02730:Lrba APN 3 86328199 missense probably damaging 1.00
IGL02883:Lrba APN 3 86354206 missense probably damaging 1.00
IGL02883:Lrba APN 3 86445413 missense probably damaging 0.99
IGL02948:Lrba APN 3 86310384 splice site probably null
IGL03090:Lrba APN 3 86773141 missense probably benign 0.01
molasses UTSW 3 86354307 critical splice donor site probably null
oscar UTSW 3 86350304 nonsense probably null
oscar2 UTSW 3 86664458 nonsense probably null
P0023:Lrba UTSW 3 86417935 missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86664494 nonsense probably null
R0077:Lrba UTSW 3 86542688 missense probably damaging 0.99
R0189:Lrba UTSW 3 86368509 missense probably damaging 1.00
R0217:Lrba UTSW 3 86642722 missense probably damaging 1.00
R0349:Lrba UTSW 3 86540005 missense probably damaging 1.00
R0396:Lrba UTSW 3 86295179 missense probably damaging 1.00
R0417:Lrba UTSW 3 86715654 missense probably damaging 1.00
R0536:Lrba UTSW 3 86715532 missense probably damaging 1.00
R0712:Lrba UTSW 3 86297990 nonsense probably null
R0722:Lrba UTSW 3 86605989 critical splice donor site probably null
R0828:Lrba UTSW 3 86608370 synonymous probably null
R0927:Lrba UTSW 3 86780233 missense probably damaging 1.00
R1120:Lrba UTSW 3 86295192 missense probably damaging 1.00
R1141:Lrba UTSW 3 86619558 missense probably damaging 1.00
R1276:Lrba UTSW 3 86664526 missense probably damaging 1.00
R1449:Lrba UTSW 3 86354278 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1474:Lrba UTSW 3 86780266 splice site probably benign
R1558:Lrba UTSW 3 86351315 missense probably damaging 1.00
R1596:Lrba UTSW 3 86350304 nonsense probably null
R1652:Lrba UTSW 3 86539938 missense probably damaging 1.00
R1800:Lrba UTSW 3 86351868 missense probably benign 0.00
R1819:Lrba UTSW 3 86542634 missense possibly damaging 0.80
R1862:Lrba UTSW 3 86773203 critical splice donor site probably null
R1917:Lrba UTSW 3 86664501 missense probably damaging 1.00
R1965:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1966:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1969:Lrba UTSW 3 86608389 missense probably damaging 0.99
R2011:Lrba UTSW 3 86310017 missense probably damaging 0.99
R2179:Lrba UTSW 3 86354281 missense probably damaging 1.00
R2186:Lrba UTSW 3 86304336 missense probably damaging 1.00
R2281:Lrba UTSW 3 86776103 missense possibly damaging 0.46
R2359:Lrba UTSW 3 86348750 missense probably benign 0.01
R2412:Lrba UTSW 3 86327700 missense probably damaging 1.00
R2496:Lrba UTSW 3 86532087 missense probably damaging 1.00
R3153:Lrba UTSW 3 86285219 missense probably damaging 0.99
R3708:Lrba UTSW 3 86285024 missense possibly damaging 0.80
R3746:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3747:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3748:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3749:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3750:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3758:Lrba UTSW 3 86776049 missense probably damaging 0.99
R3975:Lrba UTSW 3 86351255 missense probably damaging 1.00
R4210:Lrba UTSW 3 86360126 missense probably damaging 1.00
R4258:Lrba UTSW 3 86445349 missense probably damaging 1.00
R4657:Lrba UTSW 3 86737164 missense probably damaging 1.00
R4713:Lrba UTSW 3 86359868 missense probably benign 0.13
R4716:Lrba UTSW 3 86642714 missense probably damaging 0.99
R4811:Lrba UTSW 3 86776141 missense probably damaging 1.00
R4827:Lrba UTSW 3 86360150 missense possibly damaging 0.85
R4840:Lrba UTSW 3 86619509 critical splice acceptor site probably null
R4920:Lrba UTSW 3 86664458 nonsense probably null
R4948:Lrba UTSW 3 86285028 missense probably damaging 1.00
R4970:Lrba UTSW 3 86225371 missense probably benign 0.23
R4985:Lrba UTSW 3 86327436 intron probably null
R4993:Lrba UTSW 3 86360037 missense probably damaging 1.00
R5107:Lrba UTSW 3 86359779 missense possibly damaging 0.47
R5112:Lrba UTSW 3 86225371 missense probably benign 0.23
R5122:Lrba UTSW 3 86349154 nonsense probably null
R5155:Lrba UTSW 3 86351300 missense probably benign 0.25
R5194:Lrba UTSW 3 86328219 missense probably damaging 1.00
R5280:Lrba UTSW 3 86325022 missense possibly damaging 0.94
R5445:Lrba UTSW 3 86368595 missense probably benign
R5469:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5513:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5578:Lrba UTSW 3 86757507 missense probably benign 0.27
R5740:Lrba UTSW 3 86328342 missense probably damaging 1.00
R5868:Lrba UTSW 3 86319604 missense probably damaging 1.00
R6104:Lrba UTSW 3 86353792 missense probably damaging 1.00
R6166:Lrba UTSW 3 86354307 critical splice donor site probably null
R6279:Lrba UTSW 3 86348864 missense probably benign 0.26
R6330:Lrba UTSW 3 86348357 missense probably benign 0.07
R6367:Lrba UTSW 3 86368562 missense probably benign 0.42
R6571:Lrba UTSW 3 86360060 missense probably damaging 1.00
R6584:Lrba UTSW 3 86664576 missense probably damaging 1.00
R6698:Lrba UTSW 3 86304425 missense probably damaging 0.99
R6763:Lrba UTSW 3 86354263 missense probably damaging 1.00
R6834:Lrba UTSW 3 86350286 missense probably benign 0.00
R6951:Lrba UTSW 3 86745873 missense probably benign 0.01
R6969:Lrba UTSW 3 86619590 missense probably benign 0.21
R7045:Lrba UTSW 3 86285091 missense probably benign 0.03
R7133:Lrba UTSW 3 86394931 intron probably null
R7182:Lrba UTSW 3 86741458 frame shift probably null
R7214:Lrba UTSW 3 86328326 missense probably damaging 1.00
R7224:Lrba UTSW 3 86395246 missense probably damaging 1.00
R7350:Lrba UTSW 3 86351902 missense probably damaging 0.96
R7380:Lrba UTSW 3 86325074 missense probably damaging 1.00
R7492:Lrba UTSW 3 86664528 missense probably damaging 1.00
R7651:Lrba UTSW 3 86741466 nonsense probably null
R7729:Lrba UTSW 3 86318167 missense probably damaging 1.00
R7754:Lrba UTSW 3 86445397 missense probably damaging 1.00
R7762:Lrba UTSW 3 86532201 missense probably damaging 0.99
R7855:Lrba UTSW 3 86315430 missense possibly damaging 0.94
R7867:Lrba UTSW 3 86368589 missense probably damaging 1.00
R7912:Lrba UTSW 3 86715565 missense probably damaging 1.00
R7938:Lrba UTSW 3 86315430 missense possibly damaging 0.94
R7950:Lrba UTSW 3 86368589 missense probably damaging 1.00
R7993:Lrba UTSW 3 86715565 missense probably damaging 1.00
R7995:Lrba UTSW 3 86619551 missense probably damaging 1.00
R8013:Lrba UTSW 3 86417971 missense probably damaging 1.00
R8014:Lrba UTSW 3 86417971 missense probably damaging 1.00
R8024:Lrba UTSW 3 86295401 nonsense probably null
R8027:Lrba UTSW 3 86417912 missense probably benign 0.05
R8090:Lrba UTSW 3 86348489 missense probably benign
R8111:Lrba UTSW 3 86327705 missense probably damaging 1.00
R8118:Lrba UTSW 3 86354226 missense probably benign
X0065:Lrba UTSW 3 86297899 missense probably damaging 1.00
X0065:Lrba UTSW 3 86325089 missense possibly damaging 0.95
Z1176:Lrba UTSW 3 86715538 missense probably benign 0.31
Z1176:Lrba UTSW 3 86751532 missense possibly damaging 0.85
Z1177:Lrba UTSW 3 86540049 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTTACATTCTTCCAGCATTAC -3'
(R):5'- TGAACTGGCCCGCTATTTC -3'

Sequencing Primer
(F):5'- TCTTCCAGCATTACATATATTTTCCC -3'
(R):5'- TGGCCCGCTATTTCCTGAAAGG -3'
Posted On2019-10-03