Incidental Mutation 'R7243:Olfr561'
ID574690
Institutional Source Beutler Lab
Gene Symbol Olfr561
Ensembl Gene ENSMUSG00000073966
Gene Nameolfactory receptor 561
SynonymsMOR14-2, GA_x6K02T2PBJ9-5491151-5492095
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7243 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102771221-102776857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102781658 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 61 (T61S)
Ref Sequence ENSEMBL: ENSMUSP00000148106 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000210779
AA Change: T61S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213432
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Aox3 G T 1: 58,138,307 G227V unknown Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Grin2d A G 7: 45,866,128 L147P probably damaging Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Lrba T A 3: 86,751,516 probably null Het
Lrig2 A T 3: 104,497,567 probably null Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Odc1 T G 12: 17,550,057 Y407* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Ptprj T C 2: 90,446,421 H1102R probably damaging Het
Rbfox3 T C 11: 118,513,274 Y33C probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Rpgrip1l T C 8: 91,270,123 I710V probably benign Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Olfr561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr561 APN 7 102774907 missense probably damaging 0.99
IGL02743:Olfr561 APN 7 102775298 missense probably damaging 0.99
IGL03001:Olfr561 APN 7 102775253 missense probably damaging 0.98
R0254:Olfr561 UTSW 7 102774869 nonsense probably null
R0356:Olfr561 UTSW 7 102775079 missense probably damaging 1.00
R0514:Olfr561 UTSW 7 102775332 missense probably benign 0.00
R0725:Olfr561 UTSW 7 102774532 missense probably benign
R0739:Olfr561 UTSW 7 102774665 missense probably damaging 1.00
R1900:Olfr561 UTSW 7 102775331 missense probably benign 0.19
R2080:Olfr561 UTSW 7 102775243 missense probably benign 0.02
R2212:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R2379:Olfr561 UTSW 7 102774845 missense probably benign 0.33
R3412:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R3834:Olfr561 UTSW 7 102775286 missense probably damaging 1.00
R4117:Olfr561 UTSW 7 102774477 splice site probably null
R4363:Olfr561 UTSW 7 102775256 missense probably benign 0.34
R4401:Olfr561 UTSW 7 102774799 nonsense probably null
R5176:Olfr561 UTSW 7 102775306 missense probably damaging 0.99
R5464:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5465:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5493:Olfr561 UTSW 7 102775108 missense probably benign 0.00
R5540:Olfr561 UTSW 7 102774929 missense probably benign 0.02
R5629:Olfr561 UTSW 7 102774640 missense possibly damaging 0.63
R6227:Olfr561 UTSW 7 102774676 missense probably damaging 0.98
R6367:Olfr561 UTSW 7 102774829 missense possibly damaging 0.92
R6497:Olfr561 UTSW 7 102775450 missense probably benign 0.00
R7219:Olfr561 UTSW 7 102781706 missense probably benign 0.00
R7289:Olfr561 UTSW 7 102775427 missense probably damaging 1.00
R7560:Olfr561 UTSW 7 102781682 missense probably damaging 1.00
R7731:Olfr561 UTSW 7 102774934 missense probably benign 0.05
R8025:Olfr561 UTSW 7 102775256 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TACTATCATTGTAGGACACTCAGCTG -3'
(R):5'- CAACAGCACTGAGGATTCCATG -3'

Sequencing Primer
(F):5'- TGTAGGACACTCAGCTGAAAATACTG -3'
(R):5'- CACTGAGGATTCCATGACAGTG -3'
Posted On2019-10-03