Incidental Mutation 'R7257:Oca2'
ID574691
Institutional Source Beutler Lab
Gene Symbol Oca2
Ensembl Gene ENSMUSG00000030450
Gene Nameoculocutaneous albinism II
SynonymsD7H15S12, p, D7H15S12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7257 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location56239760-56536518 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 56279538 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032633] [ENSMUST00000144739] [ENSMUST00000152693] [ENSMUST00000156886]
Predicted Effect probably benign
Transcript: ENSMUST00000032633
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144739
AA Change: M117I
Predicted Effect probably benign
Transcript: ENSMUST00000152693
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156886
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Oca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
R7409:Oca2 UTSW 7 56414397 missense probably benign 0.00
R7530:Oca2 UTSW 7 56331972 missense probably damaging 0.99
R7820:Oca2 UTSW 7 56331965 missense probably damaging 1.00
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- GCATAGAATCAATGTGTGAAAGCC -3'
(R):5'- TGTTGCTGTCTACACTGTGTAC -3'

Sequencing Primer
(F):5'- TCAATGTGTGAAAGCCCAAAG -3'
(R):5'- GCTGTCTACACTGTGTACAGCAG -3'
Posted On2019-10-03