Incidental Mutation 'R7240:Puf60'
ID574703
Institutional Source Beutler Lab
Gene Symbol Puf60
Ensembl Gene ENSMUSG00000002524
Gene Namepoly-U binding splicing factor 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76070182-76080924 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 76072539 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002599] [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000100527] [ENSMUST00000109946] [ENSMUST00000227316] [ENSMUST00000230924]
Predicted Effect silent
Transcript: ENSMUST00000002599
SMART Domains Protein: ENSMUSP00000002599
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
RRM 118 191 1.21e-22 SMART
RRM 215 288 1.6e-22 SMART
low complexity region 290 338 N/A INTRINSIC
low complexity region 400 420 N/A INTRINSIC
RRM 451 533 7.68e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002603
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063747
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000100527
SMART Domains Protein: ENSMUSP00000098096
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
RRM 135 208 1.21e-22 SMART
RRM 232 305 1.6e-22 SMART
low complexity region 307 355 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
RRM 468 550 7.68e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109946
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000227316
AA Change: Y129H
Predicted Effect unknown
Transcript: ENSMUST00000230924
AA Change: Y126H
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleic acid-binding protein that plays a role in a variety of nuclear processes, including pre-mRNA splicing and transcriptional regulation. The encoded protein forms a complex with the far upstream DNA element (FUSE) and FUSE-binding protein at the myelocytomatosis oncogene (MYC) promoter. This complex represses MYC transcription through the core-TFIIH basal transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Puf60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02406:Puf60 APN 15 76074609 missense probably damaging 0.98
IGL02468:Puf60 APN 15 76075836 splice site probably benign
IGL03252:Puf60 APN 15 76071850 missense probably damaging 1.00
IGL03256:Puf60 APN 15 76070596 missense possibly damaging 0.47
IGL03344:Puf60 APN 15 76070380 missense possibly damaging 0.83
R0194:Puf60 UTSW 15 76070485 missense probably damaging 1.00
R0688:Puf60 UTSW 15 76070774 missense probably damaging 1.00
R1746:Puf60 UTSW 15 76070784 missense probably benign 0.08
R1770:Puf60 UTSW 15 76070874 missense probably benign 0.00
R1782:Puf60 UTSW 15 76071875 missense probably benign 0.32
R1818:Puf60 UTSW 15 76071474 missense possibly damaging 0.91
R2172:Puf60 UTSW 15 76070464 missense probably damaging 1.00
R4726:Puf60 UTSW 15 76072334 splice site probably null
R5049:Puf60 UTSW 15 76070474 missense probably damaging 1.00
R6927:Puf60 UTSW 15 76075814 missense probably benign
R7199:Puf60 UTSW 15 76071868 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACTCCACGAAGGCAAAGC -3'
(R):5'- TGGGTACTTCCATGTCCTGC -3'

Sequencing Primer
(F):5'- CTGAATACAGGAAGGTGTTAGAAGGC -3'
(R):5'- TAAACCCTGGCTGCAAGG -3'
Posted On2019-10-07