Incidental Mutation 'R7258:Sox30'
ID574710
Institutional Source Beutler Lab
Gene Symbol Sox30
Ensembl Gene ENSMUSG00000040489
Gene NameSRY (sex determining region Y)-box 30
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7258 (G1)
Quality Score71.0074
Status Validated
Chromosome11
Chromosomal Location45980310-46017994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45980552 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 78 (A78E)
Ref Sequence ENSEMBL: ENSMUSP00000037519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049038]
Predicted Effect unknown
Transcript: ENSMUST00000049038
AA Change: A78E
SMART Domains Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: A78E

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
low complexity region 92 104 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 210 220 N/A INTRINSIC
HMG 365 435 8.35e-24 SMART
low complexity region 523 539 N/A INTRINSIC
Blast:Pept_C1 572 734 1e-92 BLAST
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Sox30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Sox30 APN 11 45991900 missense possibly damaging 0.95
IGL01449:Sox30 APN 11 45981342 missense probably damaging 1.00
IGL02411:Sox30 APN 11 45981124 nonsense probably null
IGL02601:Sox30 APN 11 45984762 missense possibly damaging 0.81
IGL02747:Sox30 APN 11 45980945 missense probably benign 0.00
IGL03403:Sox30 APN 11 46017208 missense probably damaging 1.00
R0104:Sox30 UTSW 11 45981314 missense possibly damaging 0.93
R1450:Sox30 UTSW 11 46017271 missense probably damaging 0.99
R2109:Sox30 UTSW 11 45991768 missense probably damaging 0.99
R2213:Sox30 UTSW 11 45984852 missense probably damaging 1.00
R3715:Sox30 UTSW 11 45984792 missense probably damaging 0.99
R4111:Sox30 UTSW 11 46017214 missense probably benign 0.09
R4723:Sox30 UTSW 11 45984765 missense probably benign 0.03
R5014:Sox30 UTSW 11 45991909 missense probably benign 0.01
R5408:Sox30 UTSW 11 45991867 missense possibly damaging 0.54
R5974:Sox30 UTSW 11 45981073 missense probably damaging 0.99
R6063:Sox30 UTSW 11 45991942 missense probably benign 0.04
R6948:Sox30 UTSW 11 46017339 missense probably damaging 1.00
R7242:Sox30 UTSW 11 45984520 intron probably null
Predicted Primers PCR Primer
(F):5'- AAACGGCTGAGCTCACAATC -3'
(R):5'- GATGACTCCTTCTCCGATGG -3'

Sequencing Primer
(F):5'- TGAGCTCACAATCCCGGC -3'
(R):5'- TTTCAGCGCATCCCTCGGAG -3'
Posted On2019-10-07