Incidental Mutation 'R7406:Cops7b'
ID574717
Institutional Source Beutler Lab
Gene Symbol Cops7b
Ensembl Gene ENSMUSG00000026240
Gene NameCOP9 signalosome subunit 7B
SynonymsCOP9 complex S7b, D1Wsu66e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R7406 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location86582904-86609375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86601130 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 193 (L193Q)
Ref Sequence ENSEMBL: ENSMUSP00000027446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027446] [ENSMUST00000121534] [ENSMUST00000122884] [ENSMUST00000138280]
Predicted Effect probably benign
Transcript: ENSMUST00000027446
AA Change: L193Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027446
Gene: ENSMUSG00000026240
AA Change: L193Q

DomainStartEndE-ValueType
PINT 87 177 2.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121534
AA Change: L193Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113587
Gene: ENSMUSG00000026240
AA Change: L193Q

DomainStartEndE-ValueType
PINT 87 177 2.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122884
SMART Domains Protein: ENSMUSP00000119807
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
PDB:3CHM|A 4 78 4e-9 PDB
Blast:PINT 30 54 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138280
SMART Domains Protein: ENSMUSP00000115056
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
Blast:PINT 30 54 9e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,509 S183P possibly damaging Het
2900092C05Rik A G 7: 12,515,464 T75A possibly damaging Het
Abhd8 A G 8: 71,461,762 V74A probably benign Het
Agrn A C 4: 156,172,301 S1282R possibly damaging Het
Atf5 T C 7: 44,812,956 N248S possibly damaging Het
Atp2a3 A G 11: 72,978,750 Y497C probably damaging Het
BC053393 A G 11: 46,577,458 T120A possibly damaging Het
Bpifa2 T G 2: 154,009,819 S58R probably benign Het
Cacna1h C T 17: 25,385,626 E1238K possibly damaging Het
Ccdc71 T A 9: 108,463,324 L112* probably null Het
Cd300e A T 11: 115,055,302 I111N probably damaging Het
Cdkl3 A T 11: 52,033,542 E552D probably benign Het
Chst5 A G 8: 111,890,613 V125A probably benign Het
Clock A T 5: 76,266,845 M1K probably null Het
Csmd1 T C 8: 16,288,693 T467A probably damaging Het
Ctr9 A G 7: 111,053,408 E971G unknown Het
Dcp2 A G 18: 44,410,187 T271A probably benign Het
Dsp A G 13: 38,197,196 N2639S possibly damaging Het
Fam160a1 T C 3: 85,730,477 I172V probably benign Het
Gpr179 G T 11: 97,351,594 D141E probably damaging Het
Hist1h2bc A G 13: 23,684,359 Y43C probably damaging Het
Krt6b T G 15: 101,679,078 T194P probably benign Het
Lrp1b T C 2: 41,376,018 probably null Het
Maneal A T 4: 124,860,368 I214N possibly damaging Het
Map1lc3b T A 8: 121,590,616 C11S unknown Het
Mapt G A 11: 104,322,524 G296E possibly damaging Het
Mettl7a3 T C 15: 100,335,408 V160A probably benign Het
Mgam A G 6: 40,663,525 N509S probably benign Het
Mrgprx1 T A 7: 48,021,985 I5F possibly damaging Het
Mroh5 T C 15: 73,787,734 D416G probably benign Het
Ncan T G 8: 70,110,099 D503A probably benign Het
Ogdh A G 11: 6,348,351 T641A probably benign Het
Olfr11 T C 13: 21,639,146 I126V probably benign Het
Olfr730 T A 14: 50,186,558 I221F probably damaging Het
Olfr818 A T 10: 129,945,566 D50E probably benign Het
Olfr904 T A 9: 38,464,143 M34K possibly damaging Het
Pcdhga8 A C 18: 37,726,185 Q98P possibly damaging Het
Pik3c2a A G 7: 116,354,007 Y1218H probably damaging Het
Ppp3cc A T 14: 70,245,938 S229T possibly damaging Het
Prss43 T G 9: 110,828,696 I221S probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Serpinb9f G T 13: 33,334,560 E348* probably null Het
Sfxn5 A G 6: 85,267,907 Y169H probably damaging Het
Skint9 T C 4: 112,389,231 N228S probably benign Het
Slx4ip A T 2: 137,000,242 D29V probably damaging Het
Snx29 G T 16: 11,755,316 G474V probably damaging Het
Spata6 T A 4: 111,780,820 D282E possibly damaging Het
Srek1 A T 13: 103,769,382 V77E probably damaging Het
Tnfrsf22 T C 7: 143,640,827 D121G probably damaging Het
Ucma G A 2: 4,985,359 W122* probably null Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Vmn2r8 A G 5: 108,800,576 L482S probably benign Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr26 A T 1: 181,187,675 S390R probably damaging Het
Zbtb40 A T 4: 137,000,894 S471T probably benign Het
Other mutations in Cops7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Cops7b APN 1 86601106 missense probably damaging 1.00
IGL02505:Cops7b APN 1 86592321 missense probably benign 0.01
IGL03134:Cops7b UTSW 1 86592334 missense probably damaging 1.00
R0423:Cops7b UTSW 1 86599031 missense probably benign 0.07
R0479:Cops7b UTSW 1 86605076 missense probably benign 0.00
R1442:Cops7b UTSW 1 86605113 missense probably benign 0.00
R5004:Cops7b UTSW 1 86587410 unclassified probably benign
R5346:Cops7b UTSW 1 86583068 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGTCCAAGAAGCTGCCC -3'
(R):5'- TCCCAGTACTAAGCCCAAGG -3'

Sequencing Primer
(F):5'- GGCCTGTGTTACATATTTAGATGACC -3'
(R):5'- GCCCAAGGCGTGTTTACTG -3'
Posted On2019-10-07