Incidental Mutation 'R7406:Slx4ip'
ID574721
Institutional Source Beutler Lab
Gene Symbol Slx4ip
Ensembl Gene ENSMUSG00000027281
Gene NameSLX4 interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7406 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location136891218-137071950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137000242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 29 (D29V)
Ref Sequence ENSEMBL: ENSMUSP00000096914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028737] [ENSMUST00000099311] [ENSMUST00000141463] [ENSMUST00000180277]
Predicted Effect probably damaging
Transcript: ENSMUST00000028737
AA Change: D29V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028737
Gene: ENSMUSG00000027281
AA Change: D29V

DomainStartEndE-ValueType
low complexity region 271 292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099311
AA Change: D29V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096914
Gene: ENSMUSG00000027281
AA Change: D29V

DomainStartEndE-ValueType
Pfam:UPF0492 10 365 6.4e-170 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141463
AA Change: D45V
Predicted Effect probably damaging
Transcript: ENSMUST00000180277
AA Change: D29V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136131
Gene: ENSMUSG00000027281
AA Change: D29V

DomainStartEndE-ValueType
low complexity region 341 362 N/A INTRINSIC
Meta Mutation Damage Score 0.5003 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,509 S183P possibly damaging Het
2900092C05Rik A G 7: 12,515,464 T75A possibly damaging Het
Abhd8 A G 8: 71,461,762 V74A probably benign Het
Agrn A C 4: 156,172,301 S1282R possibly damaging Het
Atf5 T C 7: 44,812,956 N248S possibly damaging Het
Atp2a3 A G 11: 72,978,750 Y497C probably damaging Het
BC053393 A G 11: 46,577,458 T120A possibly damaging Het
Bpifa2 T G 2: 154,009,819 S58R probably benign Het
Cacna1h C T 17: 25,385,626 E1238K possibly damaging Het
Ccdc71 T A 9: 108,463,324 L112* probably null Het
Cd300e A T 11: 115,055,302 I111N probably damaging Het
Cdkl3 A T 11: 52,033,542 E552D probably benign Het
Chst5 A G 8: 111,890,613 V125A probably benign Het
Clock A T 5: 76,266,845 M1K probably null Het
Cops7b T A 1: 86,601,130 L193Q probably benign Het
Csmd1 T C 8: 16,288,693 T467A probably damaging Het
Ctr9 A G 7: 111,053,408 E971G unknown Het
Dcp2 A G 18: 44,410,187 T271A probably benign Het
Dsp A G 13: 38,197,196 N2639S possibly damaging Het
Fam160a1 T C 3: 85,730,477 I172V probably benign Het
Gm11168 C G 9: 3,006,912 C212W probably benign Het
Gpr179 G T 11: 97,351,594 D141E probably damaging Het
Hdhd2 C T 18: 76,944,115 T89M probably benign Het
Hist1h2bc A G 13: 23,684,359 Y43C probably damaging Het
Krt6b T G 15: 101,679,078 T194P probably benign Het
Lrp1b T C 2: 41,376,018 probably null Het
Maneal A T 4: 124,860,368 I214N possibly damaging Het
Map1lc3b T A 8: 121,590,616 C11S unknown Het
Mapt G A 11: 104,322,524 G296E possibly damaging Het
Mettl7a3 T C 15: 100,335,408 V160A probably benign Het
Mgam A G 6: 40,663,525 N509S probably benign Het
Mrgprx1 T A 7: 48,021,985 I5F possibly damaging Het
Mroh5 T C 15: 73,787,734 D416G probably benign Het
Ncan T G 8: 70,110,099 D503A probably benign Het
Nedd1 A T 10: 92,711,323 probably null Het
Ogdh A G 11: 6,348,351 T641A probably benign Het
Olfr11 T C 13: 21,639,146 I126V probably benign Het
Olfr730 T A 14: 50,186,558 I221F probably damaging Het
Olfr818 A T 10: 129,945,566 D50E probably benign Het
Olfr904 T A 9: 38,464,143 M34K possibly damaging Het
Pcdhga8 A C 18: 37,726,185 Q98P possibly damaging Het
Pik3c2a A G 7: 116,354,007 Y1218H probably damaging Het
Ppp3cc A T 14: 70,245,938 S229T possibly damaging Het
Prss43 T G 9: 110,828,696 I221S probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Serpinb9f G T 13: 33,334,560 E348* probably null Het
Sfxn5 A G 6: 85,267,907 Y169H probably damaging Het
Skint9 T C 4: 112,389,231 N228S probably benign Het
Snx29 G T 16: 11,755,316 G474V probably damaging Het
Spata6 T A 4: 111,780,820 D282E possibly damaging Het
Srek1 A T 13: 103,769,382 V77E probably damaging Het
Tnfrsf22 T C 7: 143,640,827 D121G probably damaging Het
Ucma G A 2: 4,985,359 W122* probably null Het
Vmn2r124 T C 17: 18,062,044 M113T unknown Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Vmn2r8 A G 5: 108,800,576 L482S probably benign Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr26 A T 1: 181,187,675 S390R probably damaging Het
Zbtb40 A T 4: 137,000,894 S471T probably benign Het
Other mutations in Slx4ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Slx4ip APN 2 137044055 nonsense probably null
IGL01546:Slx4ip APN 2 137066199 missense probably benign
IGL02114:Slx4ip APN 2 137000200 missense probably damaging 1.00
IGL02142:Slx4ip APN 2 137068022 missense possibly damaging 0.87
IGL02253:Slx4ip APN 2 137000275 critical splice donor site probably null
IGL02826:Slx4ip APN 2 137004973 missense probably damaging 1.00
IGL03035:Slx4ip APN 2 137067703 missense possibly damaging 0.50
IGL03261:Slx4ip APN 2 137046739 missense probably benign 0.01
R0561:Slx4ip UTSW 2 137066170 missense probably null 0.27
R1750:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R1774:Slx4ip UTSW 2 137067723 missense probably damaging 0.99
R1812:Slx4ip UTSW 2 137068195 missense probably benign 0.13
R1894:Slx4ip UTSW 2 137068118 missense probably benign 0.02
R1961:Slx4ip UTSW 2 137067681 missense probably benign 0.02
R2051:Slx4ip UTSW 2 137066205 missense possibly damaging 0.90
R2263:Slx4ip UTSW 2 137044015 missense probably damaging 1.00
R2914:Slx4ip UTSW 2 137067591 critical splice acceptor site probably null
R3798:Slx4ip UTSW 2 137067623 missense probably benign 0.19
R4061:Slx4ip UTSW 2 137005017 missense probably benign 0.08
R4934:Slx4ip UTSW 2 137068347 utr 3 prime probably benign
R4944:Slx4ip UTSW 2 137046767 missense probably benign 0.17
R5061:Slx4ip UTSW 2 137044010 missense probably damaging 1.00
R5465:Slx4ip UTSW 2 137004947 missense probably damaging 1.00
R5609:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R6112:Slx4ip UTSW 2 137046744 missense probably damaging 1.00
R6391:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R6525:Slx4ip UTSW 2 137000218 missense possibly damaging 0.72
R6868:Slx4ip UTSW 2 137000210 missense probably damaging 1.00
R6944:Slx4ip UTSW 2 137068275 missense probably damaging 1.00
R6966:Slx4ip UTSW 2 137068224 missense probably damaging 0.96
R7214:Slx4ip UTSW 2 137046730 missense probably benign 0.15
R7711:Slx4ip UTSW 2 137067994 missense probably damaging 1.00
R8035:Slx4ip UTSW 2 137044025 nonsense probably null
R8181:Slx4ip UTSW 2 137000184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTTGTGAACACTAGGAGC -3'
(R):5'- GCCTTTCAGTGAACGCCTAAC -3'

Sequencing Primer
(F):5'- CACTAGGAGCCATGCTGAGATTC -3'
(R):5'- CTCAGAATAGCTGACTAGCTG -3'
Posted On2019-10-07