Incidental Mutation 'R7406:Skint9'
ID574725
Institutional Source Beutler Lab
Gene Symbol Skint9
Ensembl Gene ENSMUSG00000049972
Gene Nameselection and upkeep of intraepithelial T cells 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R7406 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112385969-112433985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112389231 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 228 (N228S)
Ref Sequence ENSEMBL: ENSMUSP00000052670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058605]
Predicted Effect probably benign
Transcript: ENSMUST00000058605
AA Change: N228S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052670
Gene: ENSMUSG00000049972
AA Change: N228S

DomainStartEndE-ValueType
PDB:4F8T|A 26 125 1e-9 PDB
Blast:IG_like 32 119 8e-12 BLAST
SCOP:d1eula_ 154 245 5e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,509 S183P possibly damaging Het
2900092C05Rik A G 7: 12,515,464 T75A possibly damaging Het
Abhd8 A G 8: 71,461,762 V74A probably benign Het
Agrn A C 4: 156,172,301 S1282R possibly damaging Het
Atf5 T C 7: 44,812,956 N248S possibly damaging Het
Atp2a3 A G 11: 72,978,750 Y497C probably damaging Het
BC053393 A G 11: 46,577,458 T120A possibly damaging Het
Bpifa2 T G 2: 154,009,819 S58R probably benign Het
Cacna1h C T 17: 25,385,626 E1238K possibly damaging Het
Ccdc71 T A 9: 108,463,324 L112* probably null Het
Cd300e A T 11: 115,055,302 I111N probably damaging Het
Cdkl3 A T 11: 52,033,542 E552D probably benign Het
Chst5 A G 8: 111,890,613 V125A probably benign Het
Clock A T 5: 76,266,845 M1K probably null Het
Cops7b T A 1: 86,601,130 L193Q probably benign Het
Csmd1 T C 8: 16,288,693 T467A probably damaging Het
Ctr9 A G 7: 111,053,408 E971G unknown Het
Dcp2 A G 18: 44,410,187 T271A probably benign Het
Dsp A G 13: 38,197,196 N2639S possibly damaging Het
Fam160a1 T C 3: 85,730,477 I172V probably benign Het
Gm11168 C G 9: 3,006,912 C212W probably benign Het
Gpr179 G T 11: 97,351,594 D141E probably damaging Het
Hdhd2 C T 18: 76,944,115 T89M probably benign Het
Hist1h2bc A G 13: 23,684,359 Y43C probably damaging Het
Krt6b T G 15: 101,679,078 T194P probably benign Het
Lrp1b T C 2: 41,376,018 probably null Het
Maneal A T 4: 124,860,368 I214N possibly damaging Het
Map1lc3b T A 8: 121,590,616 C11S unknown Het
Mapt G A 11: 104,322,524 G296E possibly damaging Het
Mettl7a3 T C 15: 100,335,408 V160A probably benign Het
Mgam A G 6: 40,663,525 N509S probably benign Het
Mrgprx1 T A 7: 48,021,985 I5F possibly damaging Het
Mroh5 T C 15: 73,787,734 D416G probably benign Het
Ncan T G 8: 70,110,099 D503A probably benign Het
Nedd1 A T 10: 92,711,323 probably null Het
Ogdh A G 11: 6,348,351 T641A probably benign Het
Olfr11 T C 13: 21,639,146 I126V probably benign Het
Olfr730 T A 14: 50,186,558 I221F probably damaging Het
Olfr818 A T 10: 129,945,566 D50E probably benign Het
Olfr904 T A 9: 38,464,143 M34K possibly damaging Het
Pcdhga8 A C 18: 37,726,185 Q98P possibly damaging Het
Pik3c2a A G 7: 116,354,007 Y1218H probably damaging Het
Ppp3cc A T 14: 70,245,938 S229T possibly damaging Het
Prss43 T G 9: 110,828,696 I221S probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Serpinb9f G T 13: 33,334,560 E348* probably null Het
Sfxn5 A G 6: 85,267,907 Y169H probably damaging Het
Slx4ip A T 2: 137,000,242 D29V probably damaging Het
Snx29 G T 16: 11,755,316 G474V probably damaging Het
Spata6 T A 4: 111,780,820 D282E possibly damaging Het
Srek1 A T 13: 103,769,382 V77E probably damaging Het
Tnfrsf22 T C 7: 143,640,827 D121G probably damaging Het
Ucma G A 2: 4,985,359 W122* probably null Het
Vmn2r124 T C 17: 18,062,044 M113T unknown Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Vmn2r8 A G 5: 108,800,576 L482S probably benign Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr26 A T 1: 181,187,675 S390R probably damaging Het
Zbtb40 A T 4: 137,000,894 S471T probably benign Het
Other mutations in Skint9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02399:Skint9 APN 4 112389250 missense possibly damaging 0.88
IGL02417:Skint9 APN 4 112414138 splice site probably benign
IGL03111:Skint9 APN 4 112391724 missense probably benign 0.01
land_lubber UTSW 4 112390977 nonsense probably null
R0390:Skint9 UTSW 4 112389179 missense probably benign 0.21
R0400:Skint9 UTSW 4 112414001 missense probably damaging 1.00
R1606:Skint9 UTSW 4 112389201 missense probably benign 0.02
R1757:Skint9 UTSW 4 112413962 missense probably benign 0.03
R2431:Skint9 UTSW 4 112389267 missense probably damaging 1.00
R3195:Skint9 UTSW 4 112390951 missense probably benign 0.37
R3196:Skint9 UTSW 4 112390951 missense probably benign 0.37
R4329:Skint9 UTSW 4 112391865 missense probably damaging 0.98
R4855:Skint9 UTSW 4 112391011 missense probably benign
R4986:Skint9 UTSW 4 112391713 missense probably benign 0.00
R5093:Skint9 UTSW 4 112389250 missense probably benign 0.01
R5844:Skint9 UTSW 4 112413883 missense probably benign 0.01
R5897:Skint9 UTSW 4 112413916 missense possibly damaging 0.95
R7123:Skint9 UTSW 4 112390977 nonsense probably null
R7591:Skint9 UTSW 4 112390950 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATGGAAATGCCCCAATGTC -3'
(R):5'- ACTTTGCACAGAAATGAAGGC -3'

Sequencing Primer
(F):5'- CCTGGAGATCCTTGGATT -3'
(R):5'- GAAATGAAGGCTACTTAAAGCTTCC -3'
Posted On2019-10-07