Incidental Mutation 'R7406:Or8b1b'
ID 574747
Institutional Source Beutler Lab
Gene Symbol Or8b1b
Ensembl Gene ENSMUSG00000094380
Gene Name olfactory receptor family 8 subfamily B member 1B
Synonyms Olfr904, MOR167-3, GA_x6K02T2PVTD-32156773-32157705
MMRRC Submission 045487-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7406 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38375330-38378952 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38375439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 34 (M34K)
Ref Sequence ENSEMBL: ENSMUSP00000150057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058153] [ENSMUST00000216724]
AlphaFold Q7TRC9
Predicted Effect possibly damaging
Transcript: ENSMUST00000058153
AA Change: M34K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057148
Gene: ENSMUSG00000094380
AA Change: M34K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-51 PFAM
Pfam:7tm_1 41 291 1.5e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216724
AA Change: M34K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 85,974,231 (GRCm39) S183P possibly damaging Het
2900092C05Rik A G 7: 12,249,391 (GRCm39) T75A possibly damaging Het
Abhd8 A G 8: 71,914,406 (GRCm39) V74A probably benign Het
Agrn A C 4: 156,256,758 (GRCm39) S1282R possibly damaging Het
Atf5 T C 7: 44,462,380 (GRCm39) N248S possibly damaging Het
Atp2a3 A G 11: 72,869,576 (GRCm39) Y497C probably damaging Het
Bpifa2 T G 2: 153,851,739 (GRCm39) S58R probably benign Het
Cacna1h C T 17: 25,604,600 (GRCm39) E1238K possibly damaging Het
Ccdc71 T A 9: 108,340,523 (GRCm39) L112* probably null Het
Cd300e A T 11: 114,946,128 (GRCm39) I111N probably damaging Het
Cdkl3 A T 11: 51,924,369 (GRCm39) E552D probably benign Het
Chst5 A G 8: 112,617,245 (GRCm39) V125A probably benign Het
Clock A T 5: 76,414,692 (GRCm39) M1K probably null Het
Cops7b T A 1: 86,528,852 (GRCm39) L193Q probably benign Het
Csmd1 T C 8: 16,338,707 (GRCm39) T467A probably damaging Het
Ctr9 A G 7: 110,652,615 (GRCm39) E971G unknown Het
Dcp2 A G 18: 44,543,254 (GRCm39) T271A probably benign Het
Dsp A G 13: 38,381,172 (GRCm39) N2639S possibly damaging Het
Fhip1a T C 3: 85,637,784 (GRCm39) I172V probably benign Het
Gm11168 C G 9: 3,006,912 (GRCm39) C212W probably benign Het
Gpr179 G T 11: 97,242,420 (GRCm39) D141E probably damaging Het
H2bc4 A G 13: 23,868,342 (GRCm39) Y43C probably damaging Het
Hdhd2 C T 18: 77,031,811 (GRCm39) T89M probably benign Het
Krt6b T G 15: 101,587,513 (GRCm39) T194P probably benign Het
Lrp1b T C 2: 41,266,030 (GRCm39) probably null Het
Maneal A T 4: 124,754,161 (GRCm39) I214N possibly damaging Het
Map1lc3b T A 8: 122,317,355 (GRCm39) C11S unknown Het
Mapt G A 11: 104,213,350 (GRCm39) G296E possibly damaging Het
Mgam A G 6: 40,640,459 (GRCm39) N509S probably benign Het
Mrgprx1 T A 7: 47,671,733 (GRCm39) I5F possibly damaging Het
Mroh5 T C 15: 73,659,583 (GRCm39) D416G probably benign Het
Ncan T G 8: 70,562,749 (GRCm39) D503A probably benign Het
Nedd1 A T 10: 92,547,185 (GRCm39) probably null Het
Ogdh A G 11: 6,298,351 (GRCm39) T641A probably benign Het
Or2b6 T C 13: 21,823,316 (GRCm39) I126V probably benign Het
Or4k2 T A 14: 50,424,015 (GRCm39) I221F probably damaging Het
Or6c219 A T 10: 129,781,435 (GRCm39) D50E probably benign Het
Pcdhga8 A C 18: 37,859,238 (GRCm39) Q98P possibly damaging Het
Pik3c2a A G 7: 115,953,242 (GRCm39) Y1218H probably damaging Het
Ppp3cc A T 14: 70,483,387 (GRCm39) S229T possibly damaging Het
Prss43 T G 9: 110,657,764 (GRCm39) I221S probably damaging Het
Rasal1 A T 5: 120,801,002 (GRCm39) T221S probably benign Het
Serpinb9f G T 13: 33,518,543 (GRCm39) E348* probably null Het
Sfxn5 A G 6: 85,244,889 (GRCm39) Y169H probably damaging Het
Skint9 T C 4: 112,246,428 (GRCm39) N228S probably benign Het
Slx4ip A T 2: 136,842,162 (GRCm39) D29V probably damaging Het
Snx29 G T 16: 11,573,180 (GRCm39) G474V probably damaging Het
Spata6 T A 4: 111,638,017 (GRCm39) D282E possibly damaging Het
Srek1 A T 13: 103,905,890 (GRCm39) V77E probably damaging Het
Timd6 A G 11: 46,468,285 (GRCm39) T120A possibly damaging Het
Tmt1a3 T C 15: 100,233,289 (GRCm39) V160A probably benign Het
Tnfrsf22 T C 7: 143,194,564 (GRCm39) D121G probably damaging Het
Ucma G A 2: 4,990,170 (GRCm39) W122* probably null Het
Vmn2r124 T C 17: 18,282,306 (GRCm39) M113T unknown Het
Vmn2r54 A T 7: 12,350,150 (GRCm39) probably null Het
Vmn2r8 A G 5: 108,948,442 (GRCm39) L482S probably benign Het
Vwa3a T A 7: 120,378,138 (GRCm39) I476N probably damaging Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Wdr26 A T 1: 181,015,240 (GRCm39) S390R probably damaging Het
Zbtb40 A T 4: 136,728,205 (GRCm39) S471T probably benign Het
Other mutations in Or8b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Or8b1b APN 9 38,376,030 (GRCm39) missense probably benign
IGL01966:Or8b1b APN 9 38,376,225 (GRCm39) missense possibly damaging 0.82
IGL02328:Or8b1b APN 9 38,375,972 (GRCm39) missense probably benign
IGL03394:Or8b1b APN 9 38,375,517 (GRCm39) missense probably damaging 1.00
R0085:Or8b1b UTSW 9 38,375,958 (GRCm39) missense probably benign 0.37
R0125:Or8b1b UTSW 9 38,375,757 (GRCm39) nonsense probably null
R1506:Or8b1b UTSW 9 38,375,439 (GRCm39) missense probably benign 0.02
R1545:Or8b1b UTSW 9 38,375,815 (GRCm39) missense probably benign 0.37
R1610:Or8b1b UTSW 9 38,375,927 (GRCm39) missense probably damaging 0.97
R2008:Or8b1b UTSW 9 38,375,537 (GRCm39) missense probably damaging 1.00
R2424:Or8b1b UTSW 9 38,376,128 (GRCm39) missense probably damaging 0.99
R3824:Or8b1b UTSW 9 38,375,822 (GRCm39) missense probably benign 0.13
R3964:Or8b1b UTSW 9 38,375,979 (GRCm39) missense probably benign 0.25
R4093:Or8b1b UTSW 9 38,375,379 (GRCm39) missense probably null 1.00
R4454:Or8b1b UTSW 9 38,375,938 (GRCm39) missense probably benign 0.03
R5650:Or8b1b UTSW 9 38,376,023 (GRCm39) nonsense probably null
R6921:Or8b1b UTSW 9 38,375,543 (GRCm39) missense probably benign 0.01
R7597:Or8b1b UTSW 9 38,375,802 (GRCm39) missense probably benign 0.01
R7959:Or8b1b UTSW 9 38,376,211 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCACTGGTGGGGAAAGAACC -3'
(R):5'- GAAATATAGCTGGGTTAAACATCCC -3'

Sequencing Primer
(F):5'- CCAGGATAGGAAGAGAGATCATTTTC -3'
(R):5'- CCCATGTAAGAAATTGCATTCTTGC -3'
Posted On 2019-10-07