Incidental Mutation 'R7406:Mapt'
ID574756
Institutional Source Beutler Lab
Gene Symbol Mapt
Ensembl Gene ENSMUSG00000018411
Gene Namemicrotubule-associated protein tau
SynonymsMtapt, Tau
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7406 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104231390-104332090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104322524 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 296 (G296E)
Ref Sequence ENSEMBL: ENSMUSP00000102605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100347] [ENSMUST00000106988] [ENSMUST00000106989] [ENSMUST00000106992] [ENSMUST00000106993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100347
AA Change: G354E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097919
Gene: ENSMUSG00000018411
AA Change: G354E

DomainStartEndE-ValueType
low complexity region 127 139 N/A INTRINSIC
low complexity region 163 212 N/A INTRINSIC
Pfam:Tubulin-binding 232 263 1.4e-18 PFAM
Pfam:Tubulin-binding 264 294 3.3e-21 PFAM
Pfam:Tubulin-binding 295 325 1.6e-19 PFAM
Pfam:Tubulin-binding 326 357 1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106988
AA Change: G657E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102601
Gene: ENSMUSG00000018411
AA Change: G657E

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 466 515 N/A INTRINSIC
Pfam:Tubulin-binding 535 566 3.5e-19 PFAM
Pfam:Tubulin-binding 567 597 8.6e-22 PFAM
Pfam:Tubulin-binding 598 628 4e-20 PFAM
Pfam:Tubulin-binding 629 660 2.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106989
AA Change: G673E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102602
Gene: ENSMUSG00000018411
AA Change: G673E

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 482 531 N/A INTRINSIC
Pfam:Tubulin-binding 552 582 1.7e-13 PFAM
Pfam:Tubulin-binding 583 613 6.8e-20 PFAM
Pfam:Tubulin-binding 614 644 2.3e-17 PFAM
Pfam:Tubulin-binding 645 676 3.1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106992
AA Change: G296E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411
AA Change: G296E

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 105 154 N/A INTRINSIC
Pfam:Tubulin-binding 174 205 6.1e-19 PFAM
Pfam:Tubulin-binding 206 236 1.5e-21 PFAM
Pfam:Tubulin-binding 237 267 6.9e-20 PFAM
Pfam:Tubulin-binding 268 299 4.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106993
AA Change: G314E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102606
Gene: ENSMUSG00000018411
AA Change: G314E

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 140 172 N/A INTRINSIC
Pfam:Tubulin-binding 192 223 4.6e-19 PFAM
Pfam:Tubulin-binding 224 254 1.1e-21 PFAM
Pfam:Tubulin-binding 255 285 5.3e-20 PFAM
Pfam:Tubulin-binding 286 317 3.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit altered performance in behavioral tests and show mircotubule changes in small-calibre axons. Embryonic hippocampal cultures from mutants exhibit delayed axonal and neuritic maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,509 S183P possibly damaging Het
2900092C05Rik A G 7: 12,515,464 T75A possibly damaging Het
Abhd8 A G 8: 71,461,762 V74A probably benign Het
Agrn A C 4: 156,172,301 S1282R possibly damaging Het
Atf5 T C 7: 44,812,956 N248S possibly damaging Het
Atp2a3 A G 11: 72,978,750 Y497C probably damaging Het
BC053393 A G 11: 46,577,458 T120A possibly damaging Het
Bpifa2 T G 2: 154,009,819 S58R probably benign Het
Cacna1h C T 17: 25,385,626 E1238K possibly damaging Het
Ccdc71 T A 9: 108,463,324 L112* probably null Het
Cd300e A T 11: 115,055,302 I111N probably damaging Het
Cdkl3 A T 11: 52,033,542 E552D probably benign Het
Chst5 A G 8: 111,890,613 V125A probably benign Het
Clock A T 5: 76,266,845 M1K probably null Het
Cops7b T A 1: 86,601,130 L193Q probably benign Het
Csmd1 T C 8: 16,288,693 T467A probably damaging Het
Ctr9 A G 7: 111,053,408 E971G unknown Het
Dcp2 A G 18: 44,410,187 T271A probably benign Het
Dsp A G 13: 38,197,196 N2639S possibly damaging Het
Fam160a1 T C 3: 85,730,477 I172V probably benign Het
Gm11168 C G 9: 3,006,912 C212W probably benign Het
Gpr179 G T 11: 97,351,594 D141E probably damaging Het
Hdhd2 C T 18: 76,944,115 T89M probably benign Het
Hist1h2bc A G 13: 23,684,359 Y43C probably damaging Het
Krt6b T G 15: 101,679,078 T194P probably benign Het
Lrp1b T C 2: 41,376,018 probably null Het
Maneal A T 4: 124,860,368 I214N possibly damaging Het
Map1lc3b T A 8: 121,590,616 C11S unknown Het
Mettl7a3 T C 15: 100,335,408 V160A probably benign Het
Mgam A G 6: 40,663,525 N509S probably benign Het
Mrgprx1 T A 7: 48,021,985 I5F possibly damaging Het
Mroh5 T C 15: 73,787,734 D416G probably benign Het
Ncan T G 8: 70,110,099 D503A probably benign Het
Nedd1 A T 10: 92,711,323 probably null Het
Ogdh A G 11: 6,348,351 T641A probably benign Het
Olfr11 T C 13: 21,639,146 I126V probably benign Het
Olfr730 T A 14: 50,186,558 I221F probably damaging Het
Olfr818 A T 10: 129,945,566 D50E probably benign Het
Olfr904 T A 9: 38,464,143 M34K possibly damaging Het
Pcdhga8 A C 18: 37,726,185 Q98P possibly damaging Het
Pik3c2a A G 7: 116,354,007 Y1218H probably damaging Het
Ppp3cc A T 14: 70,245,938 S229T possibly damaging Het
Prss43 T G 9: 110,828,696 I221S probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Serpinb9f G T 13: 33,334,560 E348* probably null Het
Sfxn5 A G 6: 85,267,907 Y169H probably damaging Het
Skint9 T C 4: 112,389,231 N228S probably benign Het
Slx4ip A T 2: 137,000,242 D29V probably damaging Het
Snx29 G T 16: 11,755,316 G474V probably damaging Het
Spata6 T A 4: 111,780,820 D282E possibly damaging Het
Srek1 A T 13: 103,769,382 V77E probably damaging Het
Tnfrsf22 T C 7: 143,640,827 D121G probably damaging Het
Ucma G A 2: 4,985,359 W122* probably null Het
Vmn2r124 T C 17: 18,062,044 M113T unknown Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Vmn2r8 A G 5: 108,800,576 L482S probably benign Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr26 A T 1: 181,187,675 S390R probably damaging Het
Zbtb40 A T 4: 137,000,894 S471T probably benign Het
Other mutations in Mapt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Mapt APN 11 104322485 missense probably damaging 1.00
IGL00473:Mapt APN 11 104287183 missense probably damaging 1.00
IGL01599:Mapt APN 11 104294915 missense probably damaging 1.00
IGL01862:Mapt APN 11 104290002 intron probably benign
IGL02315:Mapt APN 11 104328078 missense probably damaging 0.99
IGL03369:Mapt APN 11 104282433 missense probably damaging 1.00
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R1913:Mapt UTSW 11 104328075 missense probably damaging 1.00
R1918:Mapt UTSW 11 104298499 missense probably benign 0.26
R3423:Mapt UTSW 11 104298722 nonsense probably null
R3425:Mapt UTSW 11 104298722 nonsense probably null
R3831:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R3833:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R4095:Mapt UTSW 11 104310536 critical splice donor site probably null
R4814:Mapt UTSW 11 104298960 missense probably benign 0.04
R4890:Mapt UTSW 11 104328149 missense probably damaging 1.00
R5613:Mapt UTSW 11 104302390 missense possibly damaging 0.82
R6415:Mapt UTSW 11 104298998 missense probably benign 0.01
R6956:Mapt UTSW 11 104318255 splice site probably null
R7395:Mapt UTSW 11 104328123 missense probably damaging 0.99
R7547:Mapt UTSW 11 104322312 intron probably null
R7554:Mapt UTSW 11 104298702 missense probably benign 0.09
R7555:Mapt UTSW 11 104298702 missense probably benign 0.09
R7556:Mapt UTSW 11 104298702 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTGCTGTGAGCTCACTTAAC -3'
(R):5'- CTATCTCCAGAGAGTCCATAGAGG -3'

Sequencing Primer
(F):5'- GCTGTGAGCTCACTTAACATATGC -3'
(R):5'- AATATAGTTCCTCATGCCGTGG -3'
Posted On2019-10-07