Incidental Mutation 'R7407:Galnt12'
ID574781
Institutional Source Beutler Lab
Gene Symbol Galnt12
Ensembl Gene ENSMUSG00000039774
Gene Namepolypeptide N-acetylgalactosaminyltransferase 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location47091909-47123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47120362 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 482 (F482L)
Ref Sequence ENSEMBL: ENSMUSP00000045721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045041] [ENSMUST00000107744]
Predicted Effect probably damaging
Transcript: ENSMUST00000045041
AA Change: F482L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045721
Gene: ENSMUSG00000039774
AA Change: F482L

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 131 375 3.4e-10 PFAM
Pfam:Glycos_transf_2 134 317 1.4e-35 PFAM
Pfam:Glyco_tranf_2_2 134 360 6.6e-8 PFAM
Pfam:Glyco_transf_7C 290 363 3e-9 PFAM
RICIN 440 572 8.09e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107744
AA Change: F190L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103373
Gene: ENSMUSG00000039774
AA Change: F190L

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 5 71 7.5e-9 PFAM
RICIN 148 280 8.09e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Galnt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Galnt12 APN 4 47112315 splice site probably benign
IGL02188:Galnt12 APN 4 47122521 missense probably damaging 1.00
IGL02217:Galnt12 APN 4 47113832 missense probably damaging 1.00
IGL02388:Galnt12 APN 4 47117941 missense probably damaging 1.00
IGL02550:Galnt12 APN 4 47104126 missense possibly damaging 0.47
IGL03062:Galnt12 APN 4 47122566 missense possibly damaging 0.80
R0508:Galnt12 UTSW 4 47104255 missense probably damaging 1.00
R1513:Galnt12 UTSW 4 47117956 missense probably damaging 1.00
R1634:Galnt12 UTSW 4 47108585 splice site probably null
R2072:Galnt12 UTSW 4 47108477 nonsense probably null
R2297:Galnt12 UTSW 4 47113834 missense probably damaging 1.00
R3113:Galnt12 UTSW 4 47108415 missense probably benign 0.01
R3157:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3158:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3159:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3725:Galnt12 UTSW 4 47104140 missense probably damaging 1.00
R4284:Galnt12 UTSW 4 47104231 missense probably damaging 1.00
R4691:Galnt12 UTSW 4 47104143 missense probably damaging 1.00
R5134:Galnt12 UTSW 4 47113818 missense probably damaging 1.00
R5408:Galnt12 UTSW 4 47104169 missense probably damaging 1.00
R5657:Galnt12 UTSW 4 47104150 missense possibly damaging 0.95
R6074:Galnt12 UTSW 4 47112405 missense probably damaging 1.00
R6406:Galnt12 UTSW 4 47122534 missense probably benign 0.00
R6721:Galnt12 UTSW 4 47122529 nonsense probably null
R7287:Galnt12 UTSW 4 47108525 missense probably damaging 1.00
R7512:Galnt12 UTSW 4 47108406 missense possibly damaging 0.83
R7810:Galnt12 UTSW 4 47113786 missense probably damaging 1.00
X0025:Galnt12 UTSW 4 47104166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCCTCACTTATTTCCAGTAGAG -3'
(R):5'- CACCGAAAGCTGCATTCACTG -3'

Sequencing Primer
(F):5'- AGAAGTGGTTCTCAGCCTTCCTAATG -3'
(R):5'- GAAAGCTGCATTCACTGACCTC -3'
Posted On2019-10-07