Incidental Mutation 'R7407:Cldn19'
ID 574782
Institutional Source Beutler Lab
Gene Symbol Cldn19
Ensembl Gene ENSMUSG00000066058
Gene Name claudin 19
Synonyms
MMRRC Submission 045488-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7407 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 119112638-119119635 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119112882 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 38 (D38G)
Ref Sequence ENSEMBL: ENSMUSP00000081334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084309] [ENSMUST00000094823]
AlphaFold Q9ET38
PDB Structure CRYSTAL STRUCTURE of MOUSE CLAUDIN-19 IN COMPLEX with C-TERMINAL FRAGMENT OF CLOSTRIDIUM PERFRINGENS ENTEROTOXIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000084309
AA Change: D38G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081334
Gene: ENSMUSG00000066058
AA Change: D38G

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 5.8e-45 PFAM
Pfam:Claudin_2 15 184 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094823
AA Change: D38G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092418
Gene: ENSMUSG00000066058
AA Change: D38G

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 6.1e-43 PFAM
Pfam:Claudin_2 15 184 2.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. siRNA knockdown of this gene in mice develops the FHHNC (familial hypomagnesemia with hypercalciuria and nephrocalcinosis) symptoms of chronic renal wasting of magnesium and calcium together with defective renal salt handling. The protein encoded by this gene interacts with another family member, Claudin 16, and their interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium. This protein is a constituent of tight junctions in the Schwann cells of peripheral myelinated nerves and the gene deficiency affects the nerve conduction of peripheral myelinated fibers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a peripheral neuropathy associated with significant behavioral abnormalities, a complete lack of tight junctions from myelinated Schwann cells, and abnormal nerve conduction parameters of peripheral myelinated fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,249,626 (GRCm39) N220S probably damaging Het
Abcb8 T C 5: 24,605,674 (GRCm39) V186A probably benign Het
Actbl2 A T 13: 111,392,752 (GRCm39) E362D probably damaging Het
Adamts17 C A 7: 66,697,304 (GRCm39) Y28* probably null Het
Agtr1b T C 3: 20,369,895 (GRCm39) D237G possibly damaging Het
Amer2 A G 14: 60,616,291 (GRCm39) D162G probably damaging Het
Ankub1 T C 3: 57,572,624 (GRCm39) E366G probably benign Het
Ap5z1 A G 5: 142,452,330 (GRCm39) I88V probably benign Het
Ccdc186 T C 19: 56,801,817 (GRCm39) N100S probably benign Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Deaf1 G A 7: 140,877,492 (GRCm39) A545V possibly damaging Het
Dicer1 G T 12: 104,688,610 (GRCm39) Y322* probably null Het
Dnajb7 G T 15: 81,291,827 (GRCm39) T170K possibly damaging Het
Flrt2 A T 12: 95,746,074 (GRCm39) E137D probably damaging Het
Galnt12 T C 4: 47,120,362 (GRCm39) F482L probably damaging Het
Gm32742 A G 9: 51,067,974 (GRCm39) V336A probably damaging Het
Gpatch8 G A 11: 102,370,656 (GRCm39) R961W unknown Het
Hcn4 A G 9: 58,766,653 (GRCm39) E738G unknown Het
Kdelr3 A G 15: 79,409,039 (GRCm39) Y76C probably damaging Het
Krt77 T C 15: 101,768,530 (GRCm39) S494G unknown Het
Letmd1 G T 15: 100,367,119 (GRCm39) A39S probably benign Het
Lrrc7 G A 3: 157,840,878 (GRCm39) R1387W probably damaging Het
Meltf T C 16: 31,713,553 (GRCm39) Y599H probably damaging Het
Mybpc1 T A 10: 88,385,209 (GRCm39) I477L probably damaging Het
Nf1 A G 11: 79,338,969 (GRCm39) D1174G probably damaging Het
Or2t6 T A 14: 14,175,402 (GRCm38) I227L probably benign Het
Or8b44 T A 9: 38,410,800 (GRCm39) Y278* probably null Het
Palld G T 8: 61,968,975 (GRCm39) S1283* probably null Het
Pcmtd2 T C 2: 181,488,398 (GRCm39) V183A possibly damaging Het
Pcsk5 T A 19: 17,652,880 (GRCm39) I269F probably damaging Het
Pkd1 T C 17: 24,813,568 (GRCm39) L4036P probably damaging Het
Pkhd1l1 A G 15: 44,458,407 (GRCm39) N4151S possibly damaging Het
Rcor3 C T 1: 191,785,972 (GRCm39) S422N probably benign Het
Rhag A G 17: 41,142,225 (GRCm39) I223V possibly damaging Het
Ssbp4 A G 8: 71,051,672 (GRCm39) Y231H probably damaging Het
Syce1l C T 8: 114,381,770 (GRCm39) Q237* probably null Het
Tenm4 T C 7: 96,423,194 (GRCm39) V663A possibly damaging Het
Timd6 A G 11: 46,468,217 (GRCm39) Y97C probably damaging Het
Trim6 T C 7: 103,875,108 (GRCm39) I115T probably damaging Het
Vinac1 A G 2: 128,880,729 (GRCm39) I399T Het
Vmn1r25 T A 6: 57,956,044 (GRCm39) T82S possibly damaging Het
Vmn2r28 A G 7: 5,484,308 (GRCm39) S631P probably damaging Het
Xpo1 T A 11: 23,235,823 (GRCm39) V637E probably damaging Het
Xpo6 A T 7: 125,770,224 (GRCm39) M62K probably damaging Het
Ypel5 A G 17: 73,153,374 (GRCm39) N26S possibly damaging Het
Zbtb24 C A 10: 41,340,775 (GRCm39) Q624K possibly damaging Het
Zfp629 T C 7: 127,209,415 (GRCm39) D798G probably benign Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Other mutations in Cldn19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Cldn19 APN 4 119,112,921 (GRCm39) nonsense probably null
R1459:Cldn19 UTSW 4 119,112,810 (GRCm39) missense probably damaging 1.00
R1524:Cldn19 UTSW 4 119,114,248 (GRCm39) critical splice donor site probably null
R1828:Cldn19 UTSW 4 119,112,990 (GRCm39) missense probably benign 0.00
R3008:Cldn19 UTSW 4 119,112,987 (GRCm39) missense probably damaging 1.00
R3709:Cldn19 UTSW 4 119,114,094 (GRCm39) missense possibly damaging 0.70
R3877:Cldn19 UTSW 4 119,114,094 (GRCm39) missense possibly damaging 0.70
R4840:Cldn19 UTSW 4 119,112,951 (GRCm39) missense probably damaging 1.00
R5238:Cldn19 UTSW 4 119,112,930 (GRCm39) missense probably damaging 1.00
R5629:Cldn19 UTSW 4 119,114,116 (GRCm39) missense probably damaging 0.98
R9591:Cldn19 UTSW 4 119,114,357 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGGAATCAGCAGCCACTG -3'
(R):5'- AGCACTAAGGACAGGCTGTG -3'

Sequencing Primer
(F):5'- GTTCCTCTTACCATGACCACAACG -3'
(R):5'- CTGTGAAAAAGCTTGCCGAC -3'
Posted On 2019-10-07