Incidental Mutation 'R7407:Ap5z1'
ID574784
Institutional Source Beutler Lab
Gene Symbol Ap5z1
Ensembl Gene ENSMUSG00000039623
Gene Nameadaptor-related protein complex 5, zeta 1 subunit
SynonymsC330006K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location142463944-142478710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142466575 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 88 (I88V)
Ref Sequence ENSEMBL: ENSMUSP00000041863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038699] [ENSMUST00000072837] [ENSMUST00000196055] [ENSMUST00000197173] [ENSMUST00000198967]
Predicted Effect probably benign
Transcript: ENSMUST00000038699
AA Change: I88V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041863
Gene: ENSMUSG00000039623
AA Change: I88V

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 319 437 2.9e-45 PFAM
low complexity region 579 584 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072837
SMART Domains Protein: ENSMUSP00000072616
Gene: ENSMUSG00000056493

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 19 84 N/A INTRINSIC
FHA 108 161 1.14e-9 SMART
low complexity region 261 281 N/A INTRINSIC
FH 289 380 1.31e-50 SMART
Blast:FH 402 458 8e-28 BLAST
low complexity region 627 642 N/A INTRINSIC
low complexity region 652 687 N/A INTRINSIC
low complexity region 696 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196055
AA Change: I88V

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143179
Gene: ENSMUSG00000039623
AA Change: I88V

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 318 758 2.6e-181 PFAM
Predicted Effect silent
Transcript: ENSMUST00000197173
SMART Domains Protein: ENSMUSP00000142777
Gene: ENSMUSG00000039623

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198967
SMART Domains Protein: ENSMUSP00000143040
Gene: ENSMUSG00000039623

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Ap5z1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ap5z1 APN 5 142472251 missense probably benign 0.02
IGL01456:Ap5z1 APN 5 142468036 missense probably damaging 0.96
IGL01656:Ap5z1 APN 5 142470314 missense probably benign 0.10
IGL02079:Ap5z1 APN 5 142477113 critical splice donor site probably null
IGL02134:Ap5z1 APN 5 142474459 missense probably benign 0.09
IGL02662:Ap5z1 APN 5 142476889 splice site probably null
IGL02805:Ap5z1 APN 5 142470283 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0094:Ap5z1 UTSW 5 142476812 missense probably benign 0.00
R0395:Ap5z1 UTSW 5 142470562 unclassified probably benign
R0811:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R0812:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R1241:Ap5z1 UTSW 5 142470114 missense probably damaging 1.00
R1248:Ap5z1 UTSW 5 142474500 missense probably benign 0.02
R1374:Ap5z1 UTSW 5 142470458 missense probably damaging 1.00
R1616:Ap5z1 UTSW 5 142472236 missense probably benign 0.10
R1923:Ap5z1 UTSW 5 142472341 missense probably benign 0.30
R2423:Ap5z1 UTSW 5 142476777 missense probably benign 0.02
R3790:Ap5z1 UTSW 5 142470413 missense probably benign
R4859:Ap5z1 UTSW 5 142473993 missense possibly damaging 0.75
R4965:Ap5z1 UTSW 5 142467676 missense probably damaging 1.00
R5147:Ap5z1 UTSW 5 142466510 missense probably benign 0.02
R5311:Ap5z1 UTSW 5 142467687 missense possibly damaging 0.79
R5531:Ap5z1 UTSW 5 142467781 missense probably benign
R5569:Ap5z1 UTSW 5 142474451 missense probably damaging 0.99
R5725:Ap5z1 UTSW 5 142468976 missense probably damaging 1.00
R7287:Ap5z1 UTSW 5 142474047 missense probably damaging 0.99
R7537:Ap5z1 UTSW 5 142477298 missense probably benign 0.06
R7894:Ap5z1 UTSW 5 142466284 missense probably benign 0.34
R7894:Ap5z1 UTSW 5 142470436 nonsense probably null
R7895:Ap5z1 UTSW 5 142470558 critical splice donor site probably null
R8022:Ap5z1 UTSW 5 142470149 critical splice donor site probably null
R8244:Ap5z1 UTSW 5 142473980 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TCGTCTCAGCCACCAAGTAC -3'
(R):5'- ACCAGCTTGCTGTATTCCTG -3'

Sequencing Primer
(F):5'- TAGGTGAGTGAGCAGCCCTG -3'
(R):5'- TGTATTCCTGAGACCTCCCAGAAC -3'
Posted On2019-10-07