Incidental Mutation 'R7407:Zfp629'
ID574792
Institutional Source Beutler Lab
Gene Symbol Zfp629
Ensembl Gene ENSMUSG00000045639
Gene Namezinc finger protein 629
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127607031-127615797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127610243 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 798 (D798G)
Ref Sequence ENSEMBL: ENSMUSP00000053760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058038] [ENSMUST00000084564] [ENSMUST00000122066] [ENSMUST00000128731] [ENSMUST00000131318] [ENSMUST00000132524] [ENSMUST00000134446] [ENSMUST00000151107] [ENSMUST00000152315]
Predicted Effect probably benign
Transcript: ENSMUST00000058038
AA Change: D798G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053760
Gene: ENSMUSG00000045639
AA Change: D798G

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084564
AA Change: D798G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081612
Gene: ENSMUSG00000045639
AA Change: D798G

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122066
AA Change: D798G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113903
Gene: ENSMUSG00000045639
AA Change: D798G

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128731
SMART Domains Protein: ENSMUSP00000140505
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131318
SMART Domains Protein: ENSMUSP00000116375
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132524
Predicted Effect probably benign
Transcript: ENSMUST00000134446
Predicted Effect probably benign
Transcript: ENSMUST00000151107
Predicted Effect probably benign
Transcript: ENSMUST00000152315
SMART Domains Protein: ENSMUSP00000114772
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 195 1.24e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Zfp629
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Zfp629 APN 7 127612724 missense probably damaging 0.97
IGL01541:Zfp629 APN 7 127612745 utr 5 prime probably benign
IGL02116:Zfp629 APN 7 127612718 missense probably damaging 1.00
IGL02134:Zfp629 APN 7 127611870 missense probably benign 0.22
IGL02547:Zfp629 APN 7 127611674 unclassified probably null
IGL02858:Zfp629 APN 7 127610312 missense probably damaging 1.00
IGL02867:Zfp629 APN 7 127610031 unclassified probably benign
IGL02889:Zfp629 APN 7 127610031 unclassified probably benign
R6768_Zfp629_044 UTSW 7 127610825 missense probably benign 0.03
R0020:Zfp629 UTSW 7 127611169 missense probably benign 0.02
R0137:Zfp629 UTSW 7 127611686 missense probably damaging 1.00
R0219:Zfp629 UTSW 7 127612083 missense probably damaging 1.00
R1061:Zfp629 UTSW 7 127611989 missense probably damaging 1.00
R1182:Zfp629 UTSW 7 127610102 missense probably damaging 1.00
R1187:Zfp629 UTSW 7 127610229 missense probably benign
R1187:Zfp629 UTSW 7 127611887 missense probably damaging 1.00
R1217:Zfp629 UTSW 7 127612744 start gained probably benign
R1507:Zfp629 UTSW 7 127611861 nonsense probably null
R1526:Zfp629 UTSW 7 127610759 missense possibly damaging 0.69
R1622:Zfp629 UTSW 7 127611840 missense probably damaging 1.00
R1704:Zfp629 UTSW 7 127610864 missense probably benign 0.06
R1918:Zfp629 UTSW 7 127612000 missense probably damaging 1.00
R2147:Zfp629 UTSW 7 127610444 missense probably damaging 1.00
R2156:Zfp629 UTSW 7 127612379 missense probably benign 0.00
R2258:Zfp629 UTSW 7 127611791 missense probably damaging 1.00
R2994:Zfp629 UTSW 7 127611056 missense probably damaging 0.99
R3735:Zfp629 UTSW 7 127612778 splice site probably benign
R4287:Zfp629 UTSW 7 127611938 missense probably damaging 1.00
R4610:Zfp629 UTSW 7 127612320 missense probably benign 0.26
R4758:Zfp629 UTSW 7 127610586 missense probably damaging 1.00
R4899:Zfp629 UTSW 7 127611018 missense possibly damaging 0.69
R4922:Zfp629 UTSW 7 127612127 missense probably damaging 1.00
R5414:Zfp629 UTSW 7 127611282 missense probably damaging 0.97
R5772:Zfp629 UTSW 7 127611135 missense probably damaging 1.00
R5907:Zfp629 UTSW 7 127610370 missense probably damaging 1.00
R6768:Zfp629 UTSW 7 127610825 missense probably benign 0.03
R7122:Zfp629 UTSW 7 127611312 missense probably damaging 0.99
R7156:Zfp629 UTSW 7 127612291 nonsense probably null
R7446:Zfp629 UTSW 7 127611029 missense probably benign 0.00
R7780:Zfp629 UTSW 7 127612429 missense probably benign 0.12
R7871:Zfp629 UTSW 7 127611995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTACTTCACAGGGAGAC -3'
(R):5'- GCAGCACCAGAAAGTCCATG -3'

Sequencing Primer
(F):5'- CTGGGTGACAGCTCCTATGG -3'
(R):5'- CCAGAAAGTCCATGCGGGTG -3'
Posted On2019-10-07