Incidental Mutation 'R7407:Deaf1'
ID574793
Institutional Source Beutler Lab
Gene Symbol Deaf1
Ensembl Gene ENSMUSG00000058886
Gene NameDEAF1, transcription factor
SynonymsC230009B13Rik, suppressin, NUDR
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141297180-141327690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141297579 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 545 (A545V)
Ref Sequence ENSEMBL: ENSMUSP00000079395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026569] [ENSMUST00000080553] [ENSMUST00000211146] [ENSMUST00000211537]
PDB Structure
LMO4-LIM2 in complex with DEAF1 (404-418) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000026569
SMART Domains Protein: ENSMUSP00000026569
Gene: ENSMUSG00000025496

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 182 9.6e-9 PFAM
Pfam:7tm_1 48 368 1.8e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080553
AA Change: A545V

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886
AA Change: A545V

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000210062
Predicted Effect probably benign
Transcript: ENSMUST00000211146
Predicted Effect probably benign
Transcript: ENSMUST00000211537
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit frequent exencephaly associated with neonatal lethality, rib cage abnormalities, and a low frequency of homeotic transformations of cervical segments but no presphenoid bone or cranial nerve defects; non-exencephalic survivors are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Deaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Deaf1 APN 7 141324181 critical splice acceptor site probably null
IGL02393:Deaf1 APN 7 141313333 missense possibly damaging 0.95
IGL03108:Deaf1 APN 7 141322961 missense probably damaging 1.00
IGL03344:Deaf1 APN 7 141297548 missense probably benign 0.08
Qball UTSW 7 141322468 missense probably damaging 1.00
R1543:Deaf1 UTSW 7 141324147 missense possibly damaging 0.65
R1702:Deaf1 UTSW 7 141314954 missense probably damaging 1.00
R2849:Deaf1 UTSW 7 141314454 makesense probably null
R4600:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4611:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4649:Deaf1 UTSW 7 141297573 missense possibly damaging 0.59
R4953:Deaf1 UTSW 7 141322468 missense probably damaging 1.00
R6349:Deaf1 UTSW 7 141322950 missense possibly damaging 0.74
R7168:Deaf1 UTSW 7 141324596 intron probably benign
R7186:Deaf1 UTSW 7 141327470 missense probably benign
R7343:Deaf1 UTSW 7 141322958 missense probably damaging 1.00
R8190:Deaf1 UTSW 7 141314411 missense probably damaging 1.00
Z1176:Deaf1 UTSW 7 141301474 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGAGCTTGTTTCCAAGGGC -3'
(R):5'- CGTTCCCTGACTAACAGCAC -3'

Sequencing Primer
(F):5'- GTTTCCAAGGGCACAATCTG -3'
(R):5'- CACAAACAGCCCCCTTAGTGTG -3'
Posted On2019-10-07