Incidental Mutation 'R7407:Palld'
ID574794
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Namepalladin, cytoskeletal associated protein
Synonyms2410003B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location61511433-61902690 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 61515941 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 1283 (S1283*)
Ref Sequence ENSEMBL: ENSMUSP00000112442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]
Predicted Effect probably null
Transcript: ENSMUST00000034057
AA Change: S1041*
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: S1041*

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121200
AA Change: S538*
SMART Domains Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056
AA Change: S538*

DomainStartEndE-ValueType
low complexity region 37 68 N/A INTRINSIC
low complexity region 77 112 N/A INTRINSIC
IGc2 293 362 3.1e-9 SMART
low complexity region 378 403 N/A INTRINSIC
IGc2 427 495 4.92e-12 SMART
IGc2 526 595 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121493
AA Change: S877*
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: S877*

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121785
AA Change: S1283*
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: S1283*

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135439
AA Change: S327*
SMART Domains Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056
AA Change: S327*

DomainStartEndE-ValueType
IGc2 82 151 3.1e-9 SMART
low complexity region 167 192 N/A INTRINSIC
IGc2 216 284 4.92e-12 SMART
internal_repeat_1 302 336 1.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61515935 missense possibly damaging 0.77
IGL01083:Palld APN 8 61538807 missense probably benign 0.44
IGL01644:Palld APN 8 61877478 missense probably benign 0.28
IGL01672:Palld APN 8 61877502 missense probably benign 0.22
IGL01941:Palld APN 8 61535700 missense probably benign 0.44
IGL02037:Palld APN 8 61525114 missense probably damaging 1.00
IGL02126:Palld APN 8 61877442 missense possibly damaging 0.82
IGL02537:Palld APN 8 61684934 missense probably benign 0.05
IGL02632:Palld APN 8 61515245 missense probably damaging 1.00
IGL02809:Palld APN 8 61515247 missense probably damaging 1.00
IGL02901:Palld APN 8 61876995 nonsense probably null
IGL03400:Palld APN 8 61513455 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0745:Palld UTSW 8 61877703 missense probably damaging 1.00
R1263:Palld UTSW 8 61513457 frame shift probably null
R1342:Palld UTSW 8 61522882 critical splice donor site probably null
R1893:Palld UTSW 8 61516621 missense probably damaging 1.00
R2017:Palld UTSW 8 61684765 missense probably damaging 0.99
R2102:Palld UTSW 8 61533433 missense possibly damaging 0.82
R2129:Palld UTSW 8 61877361 missense probably benign 0.00
R2246:Palld UTSW 8 61877135 missense probably benign 0.01
R3545:Palld UTSW 8 61550078 missense possibly damaging 0.95
R3815:Palld UTSW 8 61549837 intron probably benign
R3824:Palld UTSW 8 61709033 missense probably damaging 1.00
R4412:Palld UTSW 8 61687372 missense probably damaging 0.98
R4781:Palld UTSW 8 61877028 missense probably benign 0.01
R4836:Palld UTSW 8 61687381 missense probably benign 0.11
R4871:Palld UTSW 8 61549781 intron probably benign
R4963:Palld UTSW 8 61703210 missense probably damaging 1.00
R5036:Palld UTSW 8 61550162 missense probably damaging 1.00
R5128:Palld UTSW 8 61720588 missense probably damaging 1.00
R5343:Palld UTSW 8 61549815 intron probably benign
R5421:Palld UTSW 8 61516550 missense probably damaging 1.00
R5427:Palld UTSW 8 61550072 missense probably benign 0.01
R5561:Palld UTSW 8 61516585 missense probably damaging 1.00
R5651:Palld UTSW 8 61538788 missense probably damaging 1.00
R5679:Palld UTSW 8 61684945 missense possibly damaging 0.95
R5915:Palld UTSW 8 61533352 critical splice donor site probably null
R6153:Palld UTSW 8 61550152 missense probably damaging 1.00
R6276:Palld UTSW 8 61513423 missense probably damaging 1.00
R6323:Palld UTSW 8 61720693 missense probably damaging 1.00
R6659:Palld UTSW 8 61533443 missense probably benign 0.28
R7016:Palld UTSW 8 61515998 missense probably damaging 1.00
R7124:Palld UTSW 8 61516645 missense unknown
R7145:Palld UTSW 8 61532017 missense unknown
R7386:Palld UTSW 8 61532052 missense unknown
R7723:Palld UTSW 8 61711458 missense probably damaging 1.00
R8029:Palld UTSW 8 61877312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGCTCACCGATTTGCATG -3'
(R):5'- ACAGACCTTTGCTTGAGGG -3'

Sequencing Primer
(F):5'- ACCGATTTGCATGCAGTATCTG -3'
(R):5'- CGACGTGAAAACAGTACTTCATC -3'
Posted On2019-10-07