Incidental Mutation 'R7407:Olfr907'
ID574797
Institutional Source Beutler Lab
Gene Symbol Olfr907
Ensembl Gene ENSMUSG00000094810
Gene Nameolfactory receptor 907
SynonymsMOR165-5, GA_x6K02T2PVTD-32204729-32205661
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38495801-38499882 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38499504 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 278 (Y278*)
Ref Sequence ENSEMBL: ENSMUSP00000149897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052901] [ENSMUST00000214003] [ENSMUST00000214264]
Predicted Effect probably null
Transcript: ENSMUST00000052901
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000051531
Gene: ENSMUSG00000094810
AA Change: Y278*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-46 PFAM
Pfam:7tm_1 41 290 2.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214003
AA Change: Y278*
Predicted Effect probably null
Transcript: ENSMUST00000214264
AA Change: Y278*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Olfr907
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Olfr907 APN 9 38498875 missense probably benign 0.04
IGL01960:Olfr907 APN 9 38498707 missense probably damaging 1.00
IGL02612:Olfr907 APN 9 38499473 missense probably benign 0.01
R0366:Olfr907 UTSW 9 38499154 missense possibly damaging 0.94
R0400:Olfr907 UTSW 9 38498911 missense possibly damaging 0.63
R0726:Olfr907 UTSW 9 38499122 missense possibly damaging 0.72
R1511:Olfr907 UTSW 9 38498818 missense probably benign
R1663:Olfr907 UTSW 9 38499572 missense unknown
R1763:Olfr907 UTSW 9 38499038 missense probably damaging 1.00
R4810:Olfr907 UTSW 9 38499324 nonsense probably null
R4851:Olfr907 UTSW 9 38499023 missense probably damaging 1.00
R4945:Olfr907 UTSW 9 38499289 missense probably damaging 1.00
R5535:Olfr907 UTSW 9 38498998 missense probably benign 0.10
R5576:Olfr907 UTSW 9 38498908 missense probably damaging 1.00
R5618:Olfr907 UTSW 9 38498740 nonsense probably null
R5829:Olfr907 UTSW 9 38499249 nonsense probably null
R6249:Olfr907 UTSW 9 38499584 missense unknown
R6353:Olfr907 UTSW 9 38498816 missense probably benign 0.30
R6580:Olfr907 UTSW 9 38499023 missense probably damaging 1.00
R6611:Olfr907 UTSW 9 38499238 missense probably damaging 1.00
R6997:Olfr907 UTSW 9 38499311 missense possibly damaging 0.94
R7420:Olfr907 UTSW 9 38499063 missense probably benign 0.11
R7567:Olfr907 UTSW 9 38499073 missense probably benign 0.00
R8382:Olfr907 UTSW 9 38499292 missense probably damaging 0.98
X0028:Olfr907 UTSW 9 38499090 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCCTCTCCAGCATCCTCAAAAT -3'
(R):5'- CAAGTTACAAATTTTCCTCTTGATGG -3'

Sequencing Primer
(F):5'- TCTCCAGCATCCTCAAAATAAGCTC -3'
(R):5'- ACACACACACTACAATGAAGAATG -3'
Posted On2019-10-07