Incidental Mutation 'R7407:Gpatch8'
ID574805
Institutional Source Beutler Lab
Gene Symbol Gpatch8
Ensembl Gene ENSMUSG00000034621
Gene NameG patch domain containing 8
SynonymsENSMUSG00000075516, Fbm1, 5430405G24Rik, Gpatc8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102475915-102556392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102479830 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 961 (R961W)
Ref Sequence ENSEMBL: ENSMUSP00000120649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143842]
Predicted Effect unknown
Transcript: ENSMUST00000143842
AA Change: R961W
SMART Domains Protein: ENSMUSP00000120649
Gene: ENSMUSG00000034621
AA Change: R961W

DomainStartEndE-ValueType
G_patch 38 84 6.03e-12 SMART
coiled coil region 89 130 N/A INTRINSIC
ZnF_C2H2 136 160 6.4e0 SMART
coiled coil region 183 209 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
internal_repeat_1 307 391 1.55e-5 PROSPERO
low complexity region 474 490 N/A INTRINSIC
internal_repeat_1 583 658 1.55e-5 PROSPERO
low complexity region 666 687 N/A INTRINSIC
low complexity region 691 720 N/A INTRINSIC
low complexity region 722 753 N/A INTRINSIC
low complexity region 761 772 N/A INTRINSIC
low complexity region 798 820 N/A INTRINSIC
low complexity region 829 885 N/A INTRINSIC
low complexity region 887 980 N/A INTRINSIC
low complexity region 988 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1208 1217 N/A INTRINSIC
low complexity region 1326 1342 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1379 1404 N/A INTRINSIC
low complexity region 1438 1452 N/A INTRINSIC
low complexity region 1463 1490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an RNA-processing domain, a zinc finger domain, a lysine-rich region and a serine-rich region. A mutation in the serine-rich region of the protein is thought to be associated with hyperuricemia (PMID: 21594610). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Gpatch8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Gpatch8 APN 11 102478878 missense probably damaging 1.00
IGL00590:Gpatch8 APN 11 102480549 missense unknown
IGL00835:Gpatch8 APN 11 102478549 missense probably damaging 1.00
IGL00971:Gpatch8 APN 11 102479917 missense unknown
IGL01395:Gpatch8 APN 11 102480708 missense unknown
IGL02386:Gpatch8 APN 11 102508157 missense unknown
IGL02476:Gpatch8 APN 11 102478591 missense probably damaging 1.00
IGL02809:Gpatch8 APN 11 102487590 missense unknown
IGL02985:Gpatch8 APN 11 102481510 missense unknown
IGL03013:Gpatch8 APN 11 102508197 missense unknown
PIT4810001:Gpatch8 UTSW 11 102481842 missense unknown
R0332:Gpatch8 UTSW 11 102481842 missense unknown
R0464:Gpatch8 UTSW 11 102480886 missense unknown
R0710:Gpatch8 UTSW 11 102481933 missense unknown
R0734:Gpatch8 UTSW 11 102481400 missense unknown
R1458:Gpatch8 UTSW 11 102481229 missense unknown
R1919:Gpatch8 UTSW 11 102508142 critical splice donor site probably null
R2007:Gpatch8 UTSW 11 102500831 missense unknown
R2495:Gpatch8 UTSW 11 102478481 missense probably damaging 1.00
R2881:Gpatch8 UTSW 11 102479917 missense unknown
R2939:Gpatch8 UTSW 11 102508184 missense unknown
R4672:Gpatch8 UTSW 11 102478958 missense probably damaging 1.00
R4903:Gpatch8 UTSW 11 102480133 missense unknown
R4931:Gpatch8 UTSW 11 102481224 missense unknown
R5230:Gpatch8 UTSW 11 102479578 missense probably damaging 1.00
R5288:Gpatch8 UTSW 11 102508227 splice site probably null
R5384:Gpatch8 UTSW 11 102508227 splice site probably null
R5386:Gpatch8 UTSW 11 102508227 splice site probably null
R5564:Gpatch8 UTSW 11 102538285 missense unknown
R5668:Gpatch8 UTSW 11 102500867 missense unknown
R5954:Gpatch8 UTSW 11 102480941 missense unknown
R5966:Gpatch8 UTSW 11 102480232 missense unknown
R6018:Gpatch8 UTSW 11 102480915 missense unknown
R6176:Gpatch8 UTSW 11 102487524 missense unknown
R6388:Gpatch8 UTSW 11 102478488 missense probably damaging 1.00
R7153:Gpatch8 UTSW 11 102480188 small insertion probably benign
R7155:Gpatch8 UTSW 11 102480188 small insertion probably benign
R7163:Gpatch8 UTSW 11 102480188 small insertion probably benign
R7238:Gpatch8 UTSW 11 102478528 missense probably damaging 1.00
R7825:Gpatch8 UTSW 11 102481442 missense unknown
R8205:Gpatch8 UTSW 11 102480387 missense unknown
R8241:Gpatch8 UTSW 11 102487521 missense unknown
Z1088:Gpatch8 UTSW 11 102480945 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTTGAACGAATGAAATCCCGGC -3'
(R):5'- CTATAGCGACCGATCACGAAGG -3'

Sequencing Primer
(F):5'- AGAGCGCCTTTCCTCTGG -3'
(R):5'- GAAGGCACTCTAAGCGCTCTC -3'
Posted On2019-10-07