Incidental Mutation 'R7407:Kdelr3'
ID 574812
Institutional Source Beutler Lab
Gene Symbol Kdelr3
Ensembl Gene ENSMUSG00000010830
Gene Name KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Synonyms
MMRRC Submission 045488-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R7407 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 79400612-79411940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79409039 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 76 (Y76C)
Ref Sequence ENSEMBL: ENSMUSP00000010974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010974] [ENSMUST00000054014] [ENSMUST00000229877]
AlphaFold Q8R1L4
Predicted Effect probably damaging
Transcript: ENSMUST00000010974
AA Change: Y76C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000010974
Gene: ENSMUSG00000010830
AA Change: Y76C

DomainStartEndE-ValueType
Pfam:ER_lumen_recept 28 169 3.3e-54 PFAM
transmembrane domain 179 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054014
SMART Domains Protein: ENSMUSP00000055535
Gene: ENSMUSG00000055065

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:DEXDc 29 87 7e-18 BLAST
DEXDc 111 314 4.79e-65 SMART
HELICc 353 434 3.34e-32 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 550 576 N/A INTRINSIC
low complexity region 578 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229877
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KDEL endoplasmic reticulum protein retention receptor family. Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR3 was the third member of the family to be identified. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,249,626 (GRCm39) N220S probably damaging Het
Abcb8 T C 5: 24,605,674 (GRCm39) V186A probably benign Het
Actbl2 A T 13: 111,392,752 (GRCm39) E362D probably damaging Het
Adamts17 C A 7: 66,697,304 (GRCm39) Y28* probably null Het
Agtr1b T C 3: 20,369,895 (GRCm39) D237G possibly damaging Het
Amer2 A G 14: 60,616,291 (GRCm39) D162G probably damaging Het
Ankub1 T C 3: 57,572,624 (GRCm39) E366G probably benign Het
Ap5z1 A G 5: 142,452,330 (GRCm39) I88V probably benign Het
Ccdc186 T C 19: 56,801,817 (GRCm39) N100S probably benign Het
Cldn19 A G 4: 119,112,882 (GRCm39) D38G probably damaging Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Deaf1 G A 7: 140,877,492 (GRCm39) A545V possibly damaging Het
Dicer1 G T 12: 104,688,610 (GRCm39) Y322* probably null Het
Dnajb7 G T 15: 81,291,827 (GRCm39) T170K possibly damaging Het
Flrt2 A T 12: 95,746,074 (GRCm39) E137D probably damaging Het
Galnt12 T C 4: 47,120,362 (GRCm39) F482L probably damaging Het
Gm32742 A G 9: 51,067,974 (GRCm39) V336A probably damaging Het
Gpatch8 G A 11: 102,370,656 (GRCm39) R961W unknown Het
Hcn4 A G 9: 58,766,653 (GRCm39) E738G unknown Het
Krt77 T C 15: 101,768,530 (GRCm39) S494G unknown Het
Letmd1 G T 15: 100,367,119 (GRCm39) A39S probably benign Het
Lrrc7 G A 3: 157,840,878 (GRCm39) R1387W probably damaging Het
Meltf T C 16: 31,713,553 (GRCm39) Y599H probably damaging Het
Mybpc1 T A 10: 88,385,209 (GRCm39) I477L probably damaging Het
Nf1 A G 11: 79,338,969 (GRCm39) D1174G probably damaging Het
Or2t6 T A 14: 14,175,402 (GRCm38) I227L probably benign Het
Or8b44 T A 9: 38,410,800 (GRCm39) Y278* probably null Het
Palld G T 8: 61,968,975 (GRCm39) S1283* probably null Het
Pcmtd2 T C 2: 181,488,398 (GRCm39) V183A possibly damaging Het
Pcsk5 T A 19: 17,652,880 (GRCm39) I269F probably damaging Het
Pkd1 T C 17: 24,813,568 (GRCm39) L4036P probably damaging Het
Pkhd1l1 A G 15: 44,458,407 (GRCm39) N4151S possibly damaging Het
Rcor3 C T 1: 191,785,972 (GRCm39) S422N probably benign Het
Rhag A G 17: 41,142,225 (GRCm39) I223V possibly damaging Het
Ssbp4 A G 8: 71,051,672 (GRCm39) Y231H probably damaging Het
Syce1l C T 8: 114,381,770 (GRCm39) Q237* probably null Het
Tenm4 T C 7: 96,423,194 (GRCm39) V663A possibly damaging Het
Timd6 A G 11: 46,468,217 (GRCm39) Y97C probably damaging Het
Trim6 T C 7: 103,875,108 (GRCm39) I115T probably damaging Het
Vinac1 A G 2: 128,880,729 (GRCm39) I399T Het
Vmn1r25 T A 6: 57,956,044 (GRCm39) T82S possibly damaging Het
Vmn2r28 A G 7: 5,484,308 (GRCm39) S631P probably damaging Het
Xpo1 T A 11: 23,235,823 (GRCm39) V637E probably damaging Het
Xpo6 A T 7: 125,770,224 (GRCm39) M62K probably damaging Het
Ypel5 A G 17: 73,153,374 (GRCm39) N26S possibly damaging Het
Zbtb24 C A 10: 41,340,775 (GRCm39) Q624K possibly damaging Het
Zfp629 T C 7: 127,209,415 (GRCm39) D798G probably benign Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Other mutations in Kdelr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Kdelr3 APN 15 79,407,048 (GRCm39) missense probably damaging 1.00
IGL01772:Kdelr3 APN 15 79,407,121 (GRCm39) unclassified probably benign
IGL02437:Kdelr3 APN 15 79,409,988 (GRCm39) missense probably damaging 1.00
R1581:Kdelr3 UTSW 15 79,407,114 (GRCm39) critical splice donor site probably null
R2567:Kdelr3 UTSW 15 79,407,032 (GRCm39) missense probably benign
R4851:Kdelr3 UTSW 15 79,409,066 (GRCm39) missense possibly damaging 0.89
R5376:Kdelr3 UTSW 15 79,410,061 (GRCm39) missense possibly damaging 0.93
R5696:Kdelr3 UTSW 15 79,410,100 (GRCm39) splice site probably null
R8811:Kdelr3 UTSW 15 79,410,052 (GRCm39) missense possibly damaging 0.46
R8871:Kdelr3 UTSW 15 79,410,044 (GRCm39) nonsense probably null
R9297:Kdelr3 UTSW 15 79,411,275 (GRCm39) missense probably benign 0.00
R9318:Kdelr3 UTSW 15 79,411,275 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAACTCGTGACTCTAGGG -3'
(R):5'- TCATGGTAGAAATGCCCAGATG -3'

Sequencing Primer
(F):5'- TAGGGGCCCCAGAAACATCATG -3'
(R):5'- TGGCCGAAAAGGGTGCTG -3'
Posted On 2019-10-07