Incidental Mutation 'R7407:Dnajb7'
ID574813
Institutional Source Beutler Lab
Gene Symbol Dnajb7
Ensembl Gene ENSMUSG00000047108
Gene NameDnaJ heat shock protein family (Hsp40) member B7
Synonyms4933424H20Rik, mDj5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81406926-81408299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81407626 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 170 (T170K)
Ref Sequence ENSEMBL: ENSMUSP00000100712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041609] [ENSMUST00000057236] [ENSMUST00000163754] [ENSMUST00000165258]
Predicted Effect probably benign
Transcript: ENSMUST00000041609
SMART Domains Protein: ENSMUSP00000038331
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 366 1.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000057236
AA Change: T170K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100712
Gene: ENSMUSG00000047108
AA Change: T170K

DomainStartEndE-ValueType
DnaJ 2 61 1.49e-30 SMART
low complexity region 123 141 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 288 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163754
SMART Domains Protein: ENSMUSP00000132822
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 481 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165258
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Dnajb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Dnajb7 APN 15 81407573 missense probably benign 0.01
IGL01505:Dnajb7 APN 15 81407491 missense possibly damaging 0.46
R0116:Dnajb7 UTSW 15 81407354 missense probably benign 0.00
R1460:Dnajb7 UTSW 15 81407687 missense probably benign 0.00
R1517:Dnajb7 UTSW 15 81407456 missense probably damaging 0.98
R5354:Dnajb7 UTSW 15 81408007 missense probably damaging 1.00
R6053:Dnajb7 UTSW 15 81407299 missense probably benign 0.04
R6581:Dnajb7 UTSW 15 81408025 missense probably damaging 1.00
R7665:Dnajb7 UTSW 15 81407419 missense probably benign 0.00
R8158:Dnajb7 UTSW 15 81407399 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACGACTGTCTTCTCCAGTTAC -3'
(R):5'- AGGGATCCGTTTTCATTCCACC -3'

Sequencing Primer
(F):5'- CCAGTTACATTTGTCTGTAAAATGC -3'
(R):5'- ATCCGTTTTCATTCCACCTCTTTGAG -3'
Posted On2019-10-07