Incidental Mutation 'R7407:Meltf'
ID574816
Institutional Source Beutler Lab
Gene Symbol Meltf
Ensembl Gene ENSMUSG00000022780
Gene Namemelanotransferrin
SynonymsMTf, CD228, melanotransferrin, Mfi2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location31878810-31899020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31894735 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 599 (Y599H)
Ref Sequence ENSEMBL: ENSMUSP00000023464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023464]
Predicted Effect probably damaging
Transcript: ENSMUST00000023464
AA Change: Y599H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780
AA Change: Y599H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 23 364 2.62e-183 SMART
TR_FER 366 719 4.23e-178 SMART
low complexity region 721 734 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Meltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Meltf APN 16 31888985 missense probably damaging 1.00
IGL02942:Meltf APN 16 31890778 nonsense probably null
IGL03340:Meltf APN 16 31892784 missense probably damaging 1.00
R0734:Meltf UTSW 16 31881958 missense probably damaging 0.99
R1023:Meltf UTSW 16 31884960 missense probably damaging 1.00
R1751:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1767:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1851:Meltf UTSW 16 31896577 missense probably benign 0.00
R1900:Meltf UTSW 16 31881969 critical splice donor site probably null
R1993:Meltf UTSW 16 31892622 nonsense probably null
R3423:Meltf UTSW 16 31896525 nonsense probably null
R3425:Meltf UTSW 16 31896525 nonsense probably null
R3804:Meltf UTSW 16 31884998 missense probably benign 0.23
R4724:Meltf UTSW 16 31892505 missense probably benign 0.03
R4976:Meltf UTSW 16 31894714 missense probably benign 0.01
R5007:Meltf UTSW 16 31887562 missense possibly damaging 0.60
R5058:Meltf UTSW 16 31887603 splice site probably null
R5534:Meltf UTSW 16 31890814 critical splice donor site probably null
R5661:Meltf UTSW 16 31881926 missense possibly damaging 0.65
R6028:Meltf UTSW 16 31887476 missense possibly damaging 0.91
R6424:Meltf UTSW 16 31880262 nonsense probably null
R6464:Meltf UTSW 16 31890776 missense probably benign 0.19
R6479:Meltf UTSW 16 31881882 missense probably damaging 1.00
R6525:Meltf UTSW 16 31888899 nonsense probably null
R6629:Meltf UTSW 16 31885076 missense probably damaging 1.00
R6964:Meltf UTSW 16 31880162 missense probably benign 0.41
R7133:Meltf UTSW 16 31892799 missense probably damaging 1.00
R7169:Meltf UTSW 16 31880162 missense probably benign 0.41
R7198:Meltf UTSW 16 31883799 missense possibly damaging 0.61
R7212:Meltf UTSW 16 31890814 critical splice donor site probably null
R7246:Meltf UTSW 16 31894862 missense probably damaging 1.00
R7424:Meltf UTSW 16 31884946 missense probably damaging 1.00
R7475:Meltf UTSW 16 31881938 missense probably benign 0.12
R7727:Meltf UTSW 16 31883794 missense probably damaging 0.99
R7764:Meltf UTSW 16 31880267 missense probably benign 0.01
X0062:Meltf UTSW 16 31880200 missense probably damaging 1.00
Z1177:Meltf UTSW 16 31880234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTACTGAGTCTTCAATGTCAC -3'
(R):5'- AGCTACCTTGGGGTTTGGAC -3'

Sequencing Primer
(F):5'- CAATGTCACATTCAGCTAGTTGGGC -3'
(R):5'- GGTTTGGACCCACTCCTCG -3'
Posted On2019-10-07