Incidental Mutation 'R7407:Rhag'
ID574818
Institutional Source Beutler Lab
Gene Symbol Rhag
Ensembl Gene ENSMUSG00000023926
Gene NameRhesus blood group-associated A glycoprotein
SynonymsRh50, CD241, Rh50A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location40811126-40840754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40831334 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 223 (I223V)
Ref Sequence ENSEMBL: ENSMUSP00000024721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024721
AA Change: I223V

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024721
Gene: ENSMUSG00000023926
AA Change: I223V

DomainStartEndE-ValueType
Pfam:Ammonium_transp 43 412 1.5e-83 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is erythrocyte-specific and is thought to be part of a membrane channel that transports ammonium and carbon dioxide across the blood cell membrane. The encoded protein appears to interact with Rh blood group antigens and Rh30 polypeptides. Defects in this gene are a cause of regulator type Rh-null hemolytic anemia (RHN), or Rh-deficiency syndrome.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ammonium and methylammonium transport in red cell ghosts, reduced basal adhesion of red blood cells to endothelial cells, a slight increase in iron levels, and decreased transferrin levels in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Rhag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rhag APN 17 40811287 missense possibly damaging 0.73
IGL01463:Rhag APN 17 40828755 missense probably damaging 1.00
IGL01954:Rhag APN 17 40828450 missense possibly damaging 0.88
IGL03000:Rhag APN 17 40828522 missense probably benign 0.00
R0385:Rhag UTSW 17 40834727 missense probably damaging 0.97
R0570:Rhag UTSW 17 40828913 splice site probably benign
R0811:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R0812:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R1655:Rhag UTSW 17 40831596 missense probably damaging 0.98
R2376:Rhag UTSW 17 40811363 critical splice donor site probably null
R2698:Rhag UTSW 17 40836476 missense probably damaging 0.99
R4207:Rhag UTSW 17 40831653 missense probably damaging 0.99
R4695:Rhag UTSW 17 40836467 missense probably damaging 0.99
R4705:Rhag UTSW 17 40836438 missense probably benign 0.35
R4729:Rhag UTSW 17 40828401 missense probably damaging 1.00
R4790:Rhag UTSW 17 40831290 missense probably benign 0.23
R4895:Rhag UTSW 17 40811351 missense probably benign
R5224:Rhag UTSW 17 40828504 missense probably damaging 0.98
R5685:Rhag UTSW 17 40831331 missense possibly damaging 0.88
R7403:Rhag UTSW 17 40834658 missense probably damaging 1.00
R7553:Rhag UTSW 17 40828395 missense probably damaging 1.00
R7884:Rhag UTSW 17 40831645 missense probably benign 0.06
R8056:Rhag UTSW 17 40828788 missense probably damaging 1.00
X0064:Rhag UTSW 17 40833505 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCTATGTTGAGAGCCAGC -3'
(R):5'- CCATTTTAAAGGGTAGTTTGCTCTG -3'

Sequencing Primer
(F):5'- ATGTTGAGAGCCAGCTTCAC -3'
(R):5'- CTCTGGGAATTGACGTCTGTCC -3'
Posted On2019-10-07