Incidental Mutation 'R7408:Knl1'
ID574830
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7408 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119070592 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 925 (I925V)
Ref Sequence ENSEMBL: ENSMUSP00000028799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028799
AA Change: I925V

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: I925V

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: I925V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: I925V

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: I925V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: I925V

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,882,309 F299S probably damaging Het
Arhgap32 A T 9: 32,245,924 E72D probably benign Het
Arid1a G T 4: 133,681,080 Q1654K unknown Het
Atp6v1f A C 6: 29,470,195 H96P probably damaging Het
Cast A G 13: 74,739,841 V161A probably damaging Het
Ccdc186 A T 19: 56,808,178 C320S probably damaging Het
Cgn T A 3: 94,763,055 K1031* probably null Het
Cnot10 T C 9: 114,631,826 N92S probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cstf2t T C 19: 31,083,193 V43A possibly damaging Het
D930020B18Rik T C 10: 121,689,834 L547P probably damaging Het
Dennd1a G A 2: 37,852,172 probably null Het
Dtnb T A 12: 3,644,272 probably null Het
Entpd1 A G 19: 40,738,865 N486D possibly damaging Het
Fes G A 7: 80,378,662 R736C probably damaging Het
Galr1 T G 18: 82,393,865 Y292S probably damaging Het
Gda T A 19: 21,428,624 D80V probably damaging Het
Ghr A G 15: 3,347,572 C56R probably benign Het
Golgb1 A G 16: 36,898,547 T313A probably damaging Het
Gpaa1 A T 15: 76,332,993 D236V probably damaging Het
Gsdmc A G 15: 63,804,466 S43P probably benign Het
Gsdmd A G 15: 75,866,353 E295G probably damaging Het
Htatip2 A G 7: 49,759,786 K96R probably benign Het
Insm1 T A 2: 146,222,791 F176I probably benign Het
Itih1 T C 14: 30,943,160 E36G probably benign Het
Jak1 A G 4: 101,175,182 V409A probably damaging Het
Lcmt2 A G 2: 121,138,704 S413P probably benign Het
Lmo7 T C 14: 101,880,953 S205P probably damaging Het
Lrch3 C A 16: 32,986,743 S462* probably null Het
Lrrtm2 T C 18: 35,213,635 I205V possibly damaging Het
Mark3 T G 12: 111,633,789 N479K probably damaging Het
Mrpl19 C T 6: 81,965,812 G39D possibly damaging Het
Msh4 A G 3: 153,876,745 Y497H probably benign Het
Msl2 T A 9: 101,102,117 D563E probably benign Het
Mta1 G A 12: 113,131,468 probably null Het
Nalcn T A 14: 123,291,860 Q1401L probably benign Het
Ncapg T C 5: 45,695,793 L867P probably benign Het
Nkapl T C 13: 21,467,843 D200G unknown Het
Nos1 A C 5: 117,867,518 E101A probably damaging Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Ntng1 A G 3: 109,853,082 I358T probably benign Het
Olfr1270 T A 2: 90,149,844 H54L probably benign Het
Olfr1342 C T 4: 118,689,662 M263I probably damaging Het
Olfr715b A G 7: 107,106,067 S265P probably benign Het
Olfr745 A G 14: 50,642,395 E32G probably benign Het
Olfr794 A G 10: 129,570,624 probably benign Het
Pex1 A G 5: 3,630,222 D948G probably damaging Het
Pkd1l2 A T 8: 117,028,479 I1660N possibly damaging Het
Pkp2 T A 16: 16,261,673 Y540N possibly damaging Het
Pkp4 T C 2: 59,311,766 L471P probably damaging Het
Plekhm3 A T 1: 64,937,984 M109K probably benign Het
Plekhn1 T C 4: 156,233,961 N68S probably benign Het
Pramel7 T A 2: 87,490,845 D282V possibly damaging Het
Pxdn T C 12: 29,990,945 Y407H probably benign Het
Rab3ip T C 10: 116,937,641 D89G possibly damaging Het
Rad17 G A 13: 100,629,511 Q370* probably null Het
Robo4 T C 9: 37,410,981 C751R probably benign Het
Sez6 A G 11: 77,953,530 T60A probably damaging Het
Socs4 A G 14: 47,289,839 H77R probably benign Het
Srrm3 T A 5: 135,852,206 M120K probably benign Het
Steap4 A T 5: 7,978,453 I344F probably benign Het
Stk36 T A 1: 74,633,566 F989Y probably damaging Het
Toporsl A T 4: 52,612,108 Q667L probably benign Het
Tspan17 T C 13: 54,789,653 F20S probably benign Het
Tubgcp3 G A 8: 12,661,359 Q65* probably null Het
Ush2a A T 1: 188,733,529 I2765F probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 A G 14: 33,078,307 V1954A Het
Xrn2 T A 2: 147,042,097 probably null Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8995:Knl1 UTSW 2 119072509 missense probably benign 0.11
R9023:Knl1 UTSW 2 119070280 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCCTACAGAAGCCGAAAGTG -3'
(R):5'- CTATAGAAATCTCCATGTCCTCGG -3'

Sequencing Primer
(F):5'- CGAAAGTGACATCTCTGGCTG -3'
(R):5'- ATGTCCTCGGGCCCATATG -3'
Posted On2019-10-07