Incidental Mutation 'R7408:Steap4'
ID574844
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene NameSTEAP family member 4
SynonymsTiarp, Tnfaip9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7408 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location7960457-7982213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7978453 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 344 (I344F)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
Predicted Effect probably benign
Transcript: ENSMUST00000115421
AA Change: I344F

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: I344F

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,882,309 F299S probably damaging Het
Arhgap32 A T 9: 32,245,924 E72D probably benign Het
Arid1a G T 4: 133,681,080 Q1654K unknown Het
Atp6v1f A C 6: 29,470,195 H96P probably damaging Het
Cast A G 13: 74,739,841 V161A probably damaging Het
Ccdc186 A T 19: 56,808,178 C320S probably damaging Het
Cgn T A 3: 94,763,055 K1031* probably null Het
Cnot10 T C 9: 114,631,826 N92S probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cstf2t T C 19: 31,083,193 V43A possibly damaging Het
D930020B18Rik T C 10: 121,689,834 L547P probably damaging Het
Dennd1a G A 2: 37,852,172 probably null Het
Dtnb T A 12: 3,644,272 probably null Het
Entpd1 A G 19: 40,738,865 N486D possibly damaging Het
Fes G A 7: 80,378,662 R736C probably damaging Het
Galr1 T G 18: 82,393,865 Y292S probably damaging Het
Gda T A 19: 21,428,624 D80V probably damaging Het
Ghr A G 15: 3,347,572 C56R probably benign Het
Golgb1 A G 16: 36,898,547 T313A probably damaging Het
Gpaa1 A T 15: 76,332,993 D236V probably damaging Het
Gsdmc A G 15: 63,804,466 S43P probably benign Het
Gsdmd A G 15: 75,866,353 E295G probably damaging Het
Htatip2 A G 7: 49,759,786 K96R probably benign Het
Insm1 T A 2: 146,222,791 F176I probably benign Het
Itih1 T C 14: 30,943,160 E36G probably benign Het
Jak1 A G 4: 101,175,182 V409A probably damaging Het
Knl1 A G 2: 119,070,592 I925V possibly damaging Het
Lcmt2 A G 2: 121,138,704 S413P probably benign Het
Lmo7 T C 14: 101,880,953 S205P probably damaging Het
Lrch3 C A 16: 32,986,743 S462* probably null Het
Lrrtm2 T C 18: 35,213,635 I205V possibly damaging Het
Mark3 T G 12: 111,633,789 N479K probably damaging Het
Mrpl19 C T 6: 81,965,812 G39D possibly damaging Het
Msh4 A G 3: 153,876,745 Y497H probably benign Het
Msl2 T A 9: 101,102,117 D563E probably benign Het
Mta1 G A 12: 113,131,468 probably null Het
Nalcn T A 14: 123,291,860 Q1401L probably benign Het
Ncapg T C 5: 45,695,793 L867P probably benign Het
Nkapl T C 13: 21,467,843 D200G unknown Het
Nos1 A C 5: 117,867,518 E101A probably damaging Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Ntng1 A G 3: 109,853,082 I358T probably benign Het
Olfr1270 T A 2: 90,149,844 H54L probably benign Het
Olfr1342 C T 4: 118,689,662 M263I probably damaging Het
Olfr715b A G 7: 107,106,067 S265P probably benign Het
Olfr745 A G 14: 50,642,395 E32G probably benign Het
Olfr794 A G 10: 129,570,624 probably benign Het
Pex1 A G 5: 3,630,222 D948G probably damaging Het
Pkd1l2 A T 8: 117,028,479 I1660N possibly damaging Het
Pkp2 T A 16: 16,261,673 Y540N possibly damaging Het
Pkp4 T C 2: 59,311,766 L471P probably damaging Het
Plekhm3 A T 1: 64,937,984 M109K probably benign Het
Plekhn1 T C 4: 156,233,961 N68S probably benign Het
Pramel7 T A 2: 87,490,845 D282V possibly damaging Het
Pxdn T C 12: 29,990,945 Y407H probably benign Het
Rab3ip T C 10: 116,937,641 D89G possibly damaging Het
Rad17 G A 13: 100,629,511 Q370* probably null Het
Robo4 T C 9: 37,410,981 C751R probably benign Het
Sez6 A G 11: 77,953,530 T60A probably damaging Het
Socs4 A G 14: 47,289,839 H77R probably benign Het
Srrm3 T A 5: 135,852,206 M120K probably benign Het
Stk36 T A 1: 74,633,566 F989Y probably damaging Het
Toporsl A T 4: 52,612,108 Q667L probably benign Het
Tspan17 T C 13: 54,789,653 F20S probably benign Het
Tubgcp3 G A 8: 12,661,359 Q65* probably null Het
Ush2a A T 1: 188,733,529 I2765F probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 A G 14: 33,078,307 V1954A Het
Xrn2 T A 2: 147,042,097 probably null Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CCAAAGCTGTTCGTAAGTGG -3'
(R):5'- GCGAACTGCTAATGATGTGAC -3'

Sequencing Primer
(F):5'- AGCTGTTCGTAAGTGGTCAATAAG -3'
(R):5'- ACTGCTAATGATGTGACTAGGG -3'
Posted On2019-10-07