Incidental Mutation 'R7408:Mrpl19'
ID 574849
Institutional Source Beutler Lab
Gene Symbol Mrpl19
Ensembl Gene ENSMUSG00000030045
Gene Name mitochondrial ribosomal protein L19
Synonyms D6Ertd157e, RLX1, MRP-L15, Rpml15, 9030416F12Rik
MMRRC Submission 045489-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.928) question?
Stock # R7408 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 81934832-81942939 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 81942793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 39 (G39D)
Ref Sequence ENSEMBL: ENSMUSP00000032124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032124]
AlphaFold Q9D338
Predicted Effect possibly damaging
Transcript: ENSMUST00000032124
AA Change: G39D

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032124
Gene: ENSMUSG00000030045
AA Change: G39D

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Ribosomal_L19 92 198 9e-19 PFAM
SCOP:d1fura_ 214 282 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,860,030 (GRCm39) F299S probably damaging Het
Arhgap32 A T 9: 32,157,220 (GRCm39) E72D probably benign Het
Arid1a G T 4: 133,408,391 (GRCm39) Q1654K unknown Het
Atp6v1f A C 6: 29,470,194 (GRCm39) H96P probably damaging Het
Cast A G 13: 74,887,960 (GRCm39) V161A probably damaging Het
Ccdc186 A T 19: 56,796,610 (GRCm39) C320S probably damaging Het
Cgn T A 3: 94,670,362 (GRCm39) K1031* probably null Het
Cnot10 T C 9: 114,460,894 (GRCm39) N92S probably benign Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Cstf2t T C 19: 31,060,593 (GRCm39) V43A possibly damaging Het
D930020B18Rik T C 10: 121,525,739 (GRCm39) L547P probably damaging Het
Dennd1a G A 2: 37,742,184 (GRCm39) probably null Het
Dtnb T A 12: 3,694,272 (GRCm39) probably null Het
Entpd1 A G 19: 40,727,309 (GRCm39) N486D possibly damaging Het
Fes G A 7: 80,028,410 (GRCm39) R736C probably damaging Het
Galr1 T G 18: 82,411,990 (GRCm39) Y292S probably damaging Het
Gda T A 19: 21,405,988 (GRCm39) D80V probably damaging Het
Ghr A G 15: 3,377,054 (GRCm39) C56R probably benign Het
Golgb1 A G 16: 36,718,909 (GRCm39) T313A probably damaging Het
Gpaa1 A T 15: 76,217,193 (GRCm39) D236V probably damaging Het
Gsdmc A G 15: 63,676,315 (GRCm39) S43P probably benign Het
Gsdmd A G 15: 75,738,202 (GRCm39) E295G probably damaging Het
Htatip2 A G 7: 49,409,534 (GRCm39) K96R probably benign Het
Insm1 T A 2: 146,064,711 (GRCm39) F176I probably benign Het
Itih1 T C 14: 30,665,117 (GRCm39) E36G probably benign Het
Jak1 A G 4: 101,032,379 (GRCm39) V409A probably damaging Het
Knl1 A G 2: 118,901,073 (GRCm39) I925V possibly damaging Het
Lcmt2 A G 2: 120,969,185 (GRCm39) S413P probably benign Het
Lmo7 T C 14: 102,118,389 (GRCm39) S205P probably damaging Het
Lrch3 C A 16: 32,807,113 (GRCm39) S462* probably null Het
Lrrtm2 T C 18: 35,346,688 (GRCm39) I205V possibly damaging Het
Mark3 T G 12: 111,600,223 (GRCm39) N479K probably damaging Het
Msh4 A G 3: 153,582,382 (GRCm39) Y497H probably benign Het
Msl2 T A 9: 100,979,316 (GRCm39) D563E probably benign Het
Mta1 G A 12: 113,095,088 (GRCm39) probably null Het
Nalcn T A 14: 123,529,272 (GRCm39) Q1401L probably benign Het
Ncapg T C 5: 45,853,135 (GRCm39) L867P probably benign Het
Nkapl T C 13: 21,652,013 (GRCm39) D200G unknown Het
Nos1 A C 5: 118,005,583 (GRCm39) E101A probably damaging Het
Npat T C 9: 53,481,216 (GRCm39) S1008P probably damaging Het
Ntng1 A G 3: 109,760,398 (GRCm39) I358T probably benign Het
Or11h6 A G 14: 50,879,852 (GRCm39) E32G probably benign Het
Or13p4 C T 4: 118,546,859 (GRCm39) M263I probably damaging Het
Or2d2b A G 7: 106,705,274 (GRCm39) S265P probably benign Het
Or4b1 T A 2: 89,980,188 (GRCm39) H54L probably benign Het
Or6c88 A G 10: 129,406,493 (GRCm39) probably benign Het
Pex1 A G 5: 3,680,222 (GRCm39) D948G probably damaging Het
Pkd1l2 A T 8: 117,755,218 (GRCm39) I1660N possibly damaging Het
Pkp2 T A 16: 16,079,537 (GRCm39) Y540N possibly damaging Het
Pkp4 T C 2: 59,142,110 (GRCm39) L471P probably damaging Het
Plekhm3 A T 1: 64,977,143 (GRCm39) M109K probably benign Het
Plekhn1 T C 4: 156,318,418 (GRCm39) N68S probably benign Het
Pramel7 T A 2: 87,321,189 (GRCm39) D282V possibly damaging Het
Pxdn T C 12: 30,040,944 (GRCm39) Y407H probably benign Het
Rab3ip T C 10: 116,773,546 (GRCm39) D89G possibly damaging Het
Rad17 G A 13: 100,766,019 (GRCm39) Q370* probably null Het
Robo4 T C 9: 37,322,277 (GRCm39) C751R probably benign Het
Sez6 A G 11: 77,844,356 (GRCm39) T60A probably damaging Het
Socs4 A G 14: 47,527,296 (GRCm39) H77R probably benign Het
Srrm3 T A 5: 135,881,060 (GRCm39) M120K probably benign Het
Steap4 A T 5: 8,028,453 (GRCm39) I344F probably benign Het
Stk36 T A 1: 74,672,725 (GRCm39) F989Y probably damaging Het
Toporsl A T 4: 52,612,108 (GRCm39) Q667L probably benign Het
Tspan17 T C 13: 54,937,466 (GRCm39) F20S probably benign Het
Tubgcp3 G A 8: 12,711,359 (GRCm39) Q65* probably null Het
Ush2a A T 1: 188,465,726 (GRCm39) I2765F probably benign Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Wdfy4 A G 14: 32,800,264 (GRCm39) V1954A Het
Xrn2 T A 2: 146,884,017 (GRCm39) probably null Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Other mutations in Mrpl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Mrpl19 APN 6 81,942,853 (GRCm39) missense probably benign 0.02
IGL00563:Mrpl19 APN 6 81,942,853 (GRCm39) missense probably benign 0.02
IGL02113:Mrpl19 APN 6 81,942,896 (GRCm39) missense probably benign
IGL02116:Mrpl19 APN 6 81,942,758 (GRCm39) missense probably benign 0.41
IGL02256:Mrpl19 APN 6 81,941,300 (GRCm39) missense probably benign 0.06
IGL02347:Mrpl19 APN 6 81,938,992 (GRCm39) missense probably damaging 0.99
IGL02415:Mrpl19 APN 6 81,940,942 (GRCm39) missense probably benign 0.29
IGL02825:Mrpl19 APN 6 81,942,796 (GRCm39) missense probably benign 0.25
IGL03189:Mrpl19 APN 6 81,938,974 (GRCm39) nonsense probably null
R1824:Mrpl19 UTSW 6 81,941,060 (GRCm39) splice site probably null
R2310:Mrpl19 UTSW 6 81,941,054 (GRCm39) splice site probably null
R3176:Mrpl19 UTSW 6 81,941,047 (GRCm39) missense probably damaging 0.99
R3276:Mrpl19 UTSW 6 81,941,047 (GRCm39) missense probably damaging 0.99
R3821:Mrpl19 UTSW 6 81,938,987 (GRCm39) nonsense probably null
R4705:Mrpl19 UTSW 6 81,941,266 (GRCm39) missense probably damaging 0.99
R4736:Mrpl19 UTSW 6 81,941,329 (GRCm39) missense probably damaging 1.00
R5464:Mrpl19 UTSW 6 81,938,992 (GRCm39) missense probably damaging 0.99
R7835:Mrpl19 UTSW 6 81,939,107 (GRCm39) missense probably damaging 1.00
R7956:Mrpl19 UTSW 6 81,940,962 (GRCm39) missense probably benign 0.00
R8432:Mrpl19 UTSW 6 81,939,136 (GRCm39) missense probably damaging 1.00
Z1177:Mrpl19 UTSW 6 81,941,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGTGATCTAGAGAGGGGC -3'
(R):5'- TTTAGTCCCATAGGAGCCACC -3'

Sequencing Primer
(F):5'- AACCCGATTTCGTGCAGC -3'
(R):5'- ATAGGAGCCACCGTCCG -3'
Posted On 2019-10-07