Incidental Mutation 'R7408:Npat'
ID 574857
Institutional Source Beutler Lab
Gene Symbol Npat
Ensembl Gene ENSMUSG00000033054
Gene Name nuclear protein in the AT region
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7408 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53537047-53574342 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53569916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1008 (S1008P)
Ref Sequence ENSEMBL: ENSMUSP00000048709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035850]
AlphaFold Q8BMA5
Predicted Effect probably damaging
Transcript: ENSMUST00000035850
AA Change: S1008P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: S1008P

DomainStartEndE-ValueType
LisH 3 35 3.09e-3 SMART
low complexity region 585 592 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:NPAT_C 754 1420 4.7e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148336
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,882,309 F299S probably damaging Het
Arhgap32 A T 9: 32,245,924 E72D probably benign Het
Arid1a G T 4: 133,681,080 Q1654K unknown Het
Atp6v1f A C 6: 29,470,195 H96P probably damaging Het
Cast A G 13: 74,739,841 V161A probably damaging Het
Ccdc186 A T 19: 56,808,178 C320S probably damaging Het
Cgn T A 3: 94,763,055 K1031* probably null Het
Cnot10 T C 9: 114,631,826 N92S probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cstf2t T C 19: 31,083,193 V43A possibly damaging Het
D930020B18Rik T C 10: 121,689,834 L547P probably damaging Het
Dennd1a G A 2: 37,852,172 probably null Het
Dtnb T A 12: 3,644,272 probably null Het
Entpd1 A G 19: 40,738,865 N486D possibly damaging Het
Fes G A 7: 80,378,662 R736C probably damaging Het
Galr1 T G 18: 82,393,865 Y292S probably damaging Het
Gda T A 19: 21,428,624 D80V probably damaging Het
Ghr A G 15: 3,347,572 C56R probably benign Het
Golgb1 A G 16: 36,898,547 T313A probably damaging Het
Gpaa1 A T 15: 76,332,993 D236V probably damaging Het
Gsdmc A G 15: 63,804,466 S43P probably benign Het
Gsdmd A G 15: 75,866,353 E295G probably damaging Het
Htatip2 A G 7: 49,759,786 K96R probably benign Het
Insm1 T A 2: 146,222,791 F176I probably benign Het
Itih1 T C 14: 30,943,160 E36G probably benign Het
Jak1 A G 4: 101,175,182 V409A probably damaging Het
Knl1 A G 2: 119,070,592 I925V possibly damaging Het
Lcmt2 A G 2: 121,138,704 S413P probably benign Het
Lmo7 T C 14: 101,880,953 S205P probably damaging Het
Lrch3 C A 16: 32,986,743 S462* probably null Het
Lrrtm2 T C 18: 35,213,635 I205V possibly damaging Het
Mark3 T G 12: 111,633,789 N479K probably damaging Het
Mrpl19 C T 6: 81,965,812 G39D possibly damaging Het
Msh4 A G 3: 153,876,745 Y497H probably benign Het
Msl2 T A 9: 101,102,117 D563E probably benign Het
Mta1 G A 12: 113,131,468 probably null Het
Nalcn T A 14: 123,291,860 Q1401L probably benign Het
Ncapg T C 5: 45,695,793 L867P probably benign Het
Nkapl T C 13: 21,467,843 D200G unknown Het
Nos1 A C 5: 117,867,518 E101A probably damaging Het
Ntng1 A G 3: 109,853,082 I358T probably benign Het
Olfr1270 T A 2: 90,149,844 H54L probably benign Het
Olfr1342 C T 4: 118,689,662 M263I probably damaging Het
Olfr715b A G 7: 107,106,067 S265P probably benign Het
Olfr745 A G 14: 50,642,395 E32G probably benign Het
Olfr794 A G 10: 129,570,624 probably benign Het
Pex1 A G 5: 3,630,222 D948G probably damaging Het
Pkd1l2 A T 8: 117,028,479 I1660N possibly damaging Het
Pkp2 T A 16: 16,261,673 Y540N possibly damaging Het
Pkp4 T C 2: 59,311,766 L471P probably damaging Het
Plekhm3 A T 1: 64,937,984 M109K probably benign Het
Plekhn1 T C 4: 156,233,961 N68S probably benign Het
Pramel7 T A 2: 87,490,845 D282V possibly damaging Het
Pxdn T C 12: 29,990,945 Y407H probably benign Het
Rab3ip T C 10: 116,937,641 D89G possibly damaging Het
Rad17 G A 13: 100,629,511 Q370* probably null Het
Robo4 T C 9: 37,410,981 C751R probably benign Het
Sez6 A G 11: 77,953,530 T60A probably damaging Het
Socs4 A G 14: 47,289,839 H77R probably benign Het
Srrm3 T A 5: 135,852,206 M120K probably benign Het
Steap4 A T 5: 7,978,453 I344F probably benign Het
Stk36 T A 1: 74,633,566 F989Y probably damaging Het
Toporsl A T 4: 52,612,108 Q667L probably benign Het
Tspan17 T C 13: 54,789,653 F20S probably benign Het
Tubgcp3 G A 8: 12,661,359 Q65* probably null Het
Ush2a A T 1: 188,733,529 I2765F probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 A G 14: 33,078,307 V1954A Het
Xrn2 T A 2: 147,042,097 probably null Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Npat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Npat APN 9 53566800 missense possibly damaging 0.82
IGL00503:Npat APN 9 53572649 utr 3 prime probably benign
IGL00694:Npat APN 9 53563517 missense probably benign 0.00
IGL00731:Npat APN 9 53562086 missense probably damaging 0.99
IGL00907:Npat APN 9 53563290 missense possibly damaging 0.64
IGL00949:Npat APN 9 53563362 missense probably benign 0.17
IGL01403:Npat APN 9 53555129 missense probably benign 0.02
IGL01626:Npat APN 9 53556571 missense possibly damaging 0.92
IGL01936:Npat APN 9 53558226 splice site probably benign
IGL02142:Npat APN 9 53569907 missense probably benign
IGL02215:Npat APN 9 53559117 missense probably benign 0.00
IGL02250:Npat APN 9 53548951 nonsense probably null
IGL02624:Npat APN 9 53566810 missense probably damaging 1.00
IGL02928:Npat APN 9 53566838 splice site probably benign
IGL02931:Npat APN 9 53571041 nonsense probably null
IGL03128:Npat APN 9 53550033 splice site probably benign
IGL03238:Npat APN 9 53570426 missense probably damaging 0.98
Flotsam UTSW 9 53570570 nonsense probably null
kindling UTSW 9 53563449 missense probably damaging 0.99
R0606:Npat UTSW 9 53556481 critical splice donor site probably null
R0688:Npat UTSW 9 53570222 missense probably benign 0.18
R0839:Npat UTSW 9 53545180 missense probably damaging 0.99
R0947:Npat UTSW 9 53570324 missense probably benign 0.08
R1070:Npat UTSW 9 53572592 missense probably damaging 1.00
R1480:Npat UTSW 9 53563066 frame shift probably null
R1599:Npat UTSW 9 53562404 missense possibly damaging 0.62
R1644:Npat UTSW 9 53570172 missense probably damaging 1.00
R1646:Npat UTSW 9 53555134 missense probably benign 0.32
R1699:Npat UTSW 9 53562660 missense probably benign
R1765:Npat UTSW 9 53570222 missense probably benign 0.00
R1793:Npat UTSW 9 53552289 missense probably damaging 1.00
R1866:Npat UTSW 9 53563116 missense probably damaging 1.00
R1898:Npat UTSW 9 53563637 missense probably damaging 1.00
R2018:Npat UTSW 9 53562491 missense probably benign 0.34
R2019:Npat UTSW 9 53562491 missense probably benign 0.34
R2213:Npat UTSW 9 53552381 missense probably benign 0.00
R2432:Npat UTSW 9 53558135 missense probably damaging 1.00
R3816:Npat UTSW 9 53569916 missense probably damaging 0.99
R4764:Npat UTSW 9 53572620 missense probably damaging 1.00
R4889:Npat UTSW 9 53562207 missense probably benign 0.00
R4895:Npat UTSW 9 53570489 missense probably damaging 1.00
R4923:Npat UTSW 9 53571030 missense probably damaging 1.00
R5377:Npat UTSW 9 53550036 critical splice acceptor site probably null
R5397:Npat UTSW 9 53570474 missense probably damaging 1.00
R5504:Npat UTSW 9 53570264 missense probably benign 0.01
R5509:Npat UTSW 9 53570242 missense probably benign 0.00
R5563:Npat UTSW 9 53563127 missense probably damaging 0.97
R5677:Npat UTSW 9 53555100 missense probably benign 0.00
R5868:Npat UTSW 9 53570124 missense probably damaging 0.96
R5927:Npat UTSW 9 53562221 nonsense probably null
R6009:Npat UTSW 9 53563449 missense probably damaging 0.99
R6247:Npat UTSW 9 53545238 missense probably damaging 1.00
R6434:Npat UTSW 9 53563439 missense possibly damaging 0.81
R6784:Npat UTSW 9 53558158 missense probably damaging 1.00
R6799:Npat UTSW 9 53551630 missense probably benign 0.21
R6878:Npat UTSW 9 53556599 missense probably benign
R7027:Npat UTSW 9 53569916 missense possibly damaging 0.90
R7383:Npat UTSW 9 53562778 missense probably benign
R7404:Npat UTSW 9 53554933 splice site probably null
R7444:Npat UTSW 9 53548910 missense probably damaging 0.97
R7755:Npat UTSW 9 53559170 missense possibly damaging 0.92
R7992:Npat UTSW 9 53562867 missense probably benign 0.00
R8108:Npat UTSW 9 53571129 missense probably benign 0.00
R8126:Npat UTSW 9 53552334 missense probably benign
R8213:Npat UTSW 9 53570570 nonsense probably null
R8354:Npat UTSW 9 53566951 missense possibly damaging 0.93
R8429:Npat UTSW 9 53570609 nonsense probably null
R8454:Npat UTSW 9 53566951 missense possibly damaging 0.93
R8865:Npat UTSW 9 53570640 missense probably benign 0.00
R8894:Npat UTSW 9 53556651 missense probably damaging 1.00
R9045:Npat UTSW 9 53563476 missense possibly damaging 0.83
R9375:Npat UTSW 9 53563156 missense possibly damaging 0.69
R9511:Npat UTSW 9 53562106 missense probably benign 0.02
R9723:Npat UTSW 9 53562446 missense probably benign 0.01
R9723:Npat UTSW 9 53570561 missense probably damaging 1.00
Z1177:Npat UTSW 9 53566828 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATTTCCTCTATAGAGTGTGTGAGTC -3'
(R):5'- AGGGAAATCGTGGTGTCTTCC -3'

Sequencing Primer
(F):5'- CTGACTCATTCTCTTTCAGA -3'
(R):5'- GAAGCTTCAGTTCTACCG -3'
Posted On 2019-10-07