Incidental Mutation 'R7408:Olfr794'
ID574862
Institutional Source Beutler Lab
Gene Symbol Olfr794
Ensembl Gene ENSMUSG00000044293
Gene Nameolfactory receptor 794
SynonymsGA_x6K02T2PULF-11248702-11249664, MOR114-11
MMRRC Submission
Accession Numbers

Genbank: NM_146378

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7408 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129567655-129573110 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 129570624 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059957] [ENSMUST00000204820]
Predicted Effect probably benign
Transcript: ENSMUST00000059957
SMART Domains Protein: ENSMUSP00000049790
Gene: ENSMUSG00000044293

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204820
SMART Domains Protein: ENSMUSP00000145301
Gene: ENSMUSG00000044293

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,882,309 F299S probably damaging Het
Arhgap32 A T 9: 32,245,924 E72D probably benign Het
Arid1a G T 4: 133,681,080 Q1654K unknown Het
Atp6v1f A C 6: 29,470,195 H96P probably damaging Het
Cast A G 13: 74,739,841 V161A probably damaging Het
Ccdc186 A T 19: 56,808,178 C320S probably damaging Het
Cgn T A 3: 94,763,055 K1031* probably null Het
Cnot10 T C 9: 114,631,826 N92S probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cstf2t T C 19: 31,083,193 V43A possibly damaging Het
D930020B18Rik T C 10: 121,689,834 L547P probably damaging Het
Dennd1a G A 2: 37,852,172 probably null Het
Dtnb T A 12: 3,644,272 probably null Het
Entpd1 A G 19: 40,738,865 N486D possibly damaging Het
Fes G A 7: 80,378,662 R736C probably damaging Het
Galr1 T G 18: 82,393,865 Y292S probably damaging Het
Gda T A 19: 21,428,624 D80V probably damaging Het
Ghr A G 15: 3,347,572 C56R probably benign Het
Golgb1 A G 16: 36,898,547 T313A probably damaging Het
Gpaa1 A T 15: 76,332,993 D236V probably damaging Het
Gsdmc A G 15: 63,804,466 S43P probably benign Het
Gsdmd A G 15: 75,866,353 E295G probably damaging Het
Htatip2 A G 7: 49,759,786 K96R probably benign Het
Insm1 T A 2: 146,222,791 F176I probably benign Het
Itih1 T C 14: 30,943,160 E36G probably benign Het
Jak1 A G 4: 101,175,182 V409A probably damaging Het
Knl1 A G 2: 119,070,592 I925V possibly damaging Het
Lcmt2 A G 2: 121,138,704 S413P probably benign Het
Lmo7 T C 14: 101,880,953 S205P probably damaging Het
Lrch3 C A 16: 32,986,743 S462* probably null Het
Lrrtm2 T C 18: 35,213,635 I205V possibly damaging Het
Mark3 T G 12: 111,633,789 N479K probably damaging Het
Mrpl19 C T 6: 81,965,812 G39D possibly damaging Het
Msh4 A G 3: 153,876,745 Y497H probably benign Het
Msl2 T A 9: 101,102,117 D563E probably benign Het
Mta1 G A 12: 113,131,468 probably null Het
Nalcn T A 14: 123,291,860 Q1401L probably benign Het
Ncapg T C 5: 45,695,793 L867P probably benign Het
Nkapl T C 13: 21,467,843 D200G unknown Het
Nos1 A C 5: 117,867,518 E101A probably damaging Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Ntng1 A G 3: 109,853,082 I358T probably benign Het
Olfr1270 T A 2: 90,149,844 H54L probably benign Het
Olfr1342 C T 4: 118,689,662 M263I probably damaging Het
Olfr715b A G 7: 107,106,067 S265P probably benign Het
Olfr745 A G 14: 50,642,395 E32G probably benign Het
Pex1 A G 5: 3,630,222 D948G probably damaging Het
Pkd1l2 A T 8: 117,028,479 I1660N possibly damaging Het
Pkp2 T A 16: 16,261,673 Y540N possibly damaging Het
Pkp4 T C 2: 59,311,766 L471P probably damaging Het
Plekhm3 A T 1: 64,937,984 M109K probably benign Het
Plekhn1 T C 4: 156,233,961 N68S probably benign Het
Pramel7 T A 2: 87,490,845 D282V possibly damaging Het
Pxdn T C 12: 29,990,945 Y407H probably benign Het
Rab3ip T C 10: 116,937,641 D89G possibly damaging Het
Rad17 G A 13: 100,629,511 Q370* probably null Het
Robo4 T C 9: 37,410,981 C751R probably benign Het
Sez6 A G 11: 77,953,530 T60A probably damaging Het
Socs4 A G 14: 47,289,839 H77R probably benign Het
Srrm3 T A 5: 135,852,206 M120K probably benign Het
Steap4 A T 5: 7,978,453 I344F probably benign Het
Stk36 T A 1: 74,633,566 F989Y probably damaging Het
Toporsl A T 4: 52,612,108 Q667L probably benign Het
Tspan17 T C 13: 54,789,653 F20S probably benign Het
Tubgcp3 G A 8: 12,661,359 Q65* probably null Het
Ush2a A T 1: 188,733,529 I2765F probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 A G 14: 33,078,307 V1954A Het
Xrn2 T A 2: 147,042,097 probably null Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Olfr794
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Olfr794 APN 10 129570827 missense possibly damaging 0.95
IGL02157:Olfr794 APN 10 129571150 missense probably damaging 1.00
IGL02804:Olfr794 APN 10 129571437 missense possibly damaging 0.60
IGL02833:Olfr794 APN 10 129570750 missense probably benign 0.26
IGL02930:Olfr794 APN 10 129571315 missense probably damaging 1.00
IGL03038:Olfr794 APN 10 129570921 missense probably benign 0.07
G4846:Olfr794 UTSW 10 129571170 missense probably damaging 1.00
R1539:Olfr794 UTSW 10 129570771 missense probably damaging 0.99
R1737:Olfr794 UTSW 10 129570828 missense probably damaging 1.00
R1845:Olfr794 UTSW 10 129571348 missense probably damaging 1.00
R2198:Olfr794 UTSW 10 129571046 nonsense probably null
R3086:Olfr794 UTSW 10 129571407 missense probably damaging 1.00
R4960:Olfr794 UTSW 10 129571026 missense probably damaging 1.00
R5938:Olfr794 UTSW 10 129571527 missense probably damaging 1.00
R6326:Olfr794 UTSW 10 129570702 missense possibly damaging 0.74
R6598:Olfr794 UTSW 10 129571369 missense probably damaging 1.00
R7034:Olfr794 UTSW 10 129571072 missense possibly damaging 0.91
R7066:Olfr794 UTSW 10 129571504 missense probably damaging 1.00
R7226:Olfr794 UTSW 10 129570715 missense probably benign 0.01
R7324:Olfr794 UTSW 10 129570849 missense probably damaging 1.00
R7779:Olfr794 UTSW 10 129571311 missense probably damaging 1.00
Z1176:Olfr794 UTSW 10 129571236 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGTTGGCTATGGCATTG -3'
(R):5'- TGAGAGTCCATCAGGGTGAG -3'

Sequencing Primer
(F):5'- CACTGTTGGCTATGGCATTGAAAATG -3'
(R):5'- AGAATGATGATTGTCAGGTTCCCC -3'
Posted On2019-10-07