Incidental Mutation 'R7408:Sez6'
ID574863
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Nameseizure related gene 6
SynonymsD11Bhm177e, sez-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7408 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77930800-77979048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77953530 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 60 (T60A)
Ref Sequence ENSEMBL: ENSMUSP00000091532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000646
AA Change: T60A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: T60A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093995
AA Change: T60A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: T60A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151982
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,882,309 F299S probably damaging Het
Arhgap32 A T 9: 32,245,924 E72D probably benign Het
Arid1a G T 4: 133,681,080 Q1654K unknown Het
Atp6v1f A C 6: 29,470,195 H96P probably damaging Het
Cast A G 13: 74,739,841 V161A probably damaging Het
Ccdc186 A T 19: 56,808,178 C320S probably damaging Het
Cgn T A 3: 94,763,055 K1031* probably null Het
Cnot10 T C 9: 114,631,826 N92S probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cstf2t T C 19: 31,083,193 V43A possibly damaging Het
D930020B18Rik T C 10: 121,689,834 L547P probably damaging Het
Dennd1a G A 2: 37,852,172 probably null Het
Dtnb T A 12: 3,644,272 probably null Het
Entpd1 A G 19: 40,738,865 N486D possibly damaging Het
Fes G A 7: 80,378,662 R736C probably damaging Het
Galr1 T G 18: 82,393,865 Y292S probably damaging Het
Gda T A 19: 21,428,624 D80V probably damaging Het
Ghr A G 15: 3,347,572 C56R probably benign Het
Golgb1 A G 16: 36,898,547 T313A probably damaging Het
Gpaa1 A T 15: 76,332,993 D236V probably damaging Het
Gsdmc A G 15: 63,804,466 S43P probably benign Het
Gsdmd A G 15: 75,866,353 E295G probably damaging Het
Htatip2 A G 7: 49,759,786 K96R probably benign Het
Insm1 T A 2: 146,222,791 F176I probably benign Het
Itih1 T C 14: 30,943,160 E36G probably benign Het
Jak1 A G 4: 101,175,182 V409A probably damaging Het
Knl1 A G 2: 119,070,592 I925V possibly damaging Het
Lcmt2 A G 2: 121,138,704 S413P probably benign Het
Lmo7 T C 14: 101,880,953 S205P probably damaging Het
Lrch3 C A 16: 32,986,743 S462* probably null Het
Lrrtm2 T C 18: 35,213,635 I205V possibly damaging Het
Mark3 T G 12: 111,633,789 N479K probably damaging Het
Mrpl19 C T 6: 81,965,812 G39D possibly damaging Het
Msh4 A G 3: 153,876,745 Y497H probably benign Het
Msl2 T A 9: 101,102,117 D563E probably benign Het
Mta1 G A 12: 113,131,468 probably null Het
Nalcn T A 14: 123,291,860 Q1401L probably benign Het
Ncapg T C 5: 45,695,793 L867P probably benign Het
Nkapl T C 13: 21,467,843 D200G unknown Het
Nos1 A C 5: 117,867,518 E101A probably damaging Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Ntng1 A G 3: 109,853,082 I358T probably benign Het
Olfr1270 T A 2: 90,149,844 H54L probably benign Het
Olfr1342 C T 4: 118,689,662 M263I probably damaging Het
Olfr715b A G 7: 107,106,067 S265P probably benign Het
Olfr745 A G 14: 50,642,395 E32G probably benign Het
Olfr794 A G 10: 129,570,624 probably benign Het
Pex1 A G 5: 3,630,222 D948G probably damaging Het
Pkd1l2 A T 8: 117,028,479 I1660N possibly damaging Het
Pkp2 T A 16: 16,261,673 Y540N possibly damaging Het
Pkp4 T C 2: 59,311,766 L471P probably damaging Het
Plekhm3 A T 1: 64,937,984 M109K probably benign Het
Plekhn1 T C 4: 156,233,961 N68S probably benign Het
Pramel7 T A 2: 87,490,845 D282V possibly damaging Het
Pxdn T C 12: 29,990,945 Y407H probably benign Het
Rab3ip T C 10: 116,937,641 D89G possibly damaging Het
Rad17 G A 13: 100,629,511 Q370* probably null Het
Robo4 T C 9: 37,410,981 C751R probably benign Het
Socs4 A G 14: 47,289,839 H77R probably benign Het
Srrm3 T A 5: 135,852,206 M120K probably benign Het
Steap4 A T 5: 7,978,453 I344F probably benign Het
Stk36 T A 1: 74,633,566 F989Y probably damaging Het
Toporsl A T 4: 52,612,108 Q667L probably benign Het
Tspan17 T C 13: 54,789,653 F20S probably benign Het
Tubgcp3 G A 8: 12,661,359 Q65* probably null Het
Ush2a A T 1: 188,733,529 I2765F probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 A G 14: 33,078,307 V1954A Het
Xrn2 T A 2: 147,042,097 probably null Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77977289 splice site probably benign
IGL01142:Sez6 APN 11 77973816 missense probably damaging 1.00
IGL02252:Sez6 APN 11 77974513 missense probably damaging 1.00
IGL02332:Sez6 APN 11 77954742 splice site probably benign
IGL02366:Sez6 APN 11 77976882 missense probably damaging 0.98
IGL02479:Sez6 APN 11 77978026 missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77962949 missense possibly damaging 0.93
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0089:Sez6 UTSW 11 77974344 splice site probably benign
R0485:Sez6 UTSW 11 77953813 missense probably damaging 1.00
R0598:Sez6 UTSW 11 77977821 missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77976585 missense probably benign 0.01
R1117:Sez6 UTSW 11 77974514 missense probably damaging 1.00
R1199:Sez6 UTSW 11 77953885 missense probably benign
R1534:Sez6 UTSW 11 77963045 missense probably damaging 1.00
R1835:Sez6 UTSW 11 77953503 missense probably benign
R1840:Sez6 UTSW 11 77953717 missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77972932 missense probably damaging 1.00
R1970:Sez6 UTSW 11 77954068 critical splice donor site probably null
R3156:Sez6 UTSW 11 77953779 missense possibly damaging 0.63
R3930:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R3931:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R4894:Sez6 UTSW 11 77975260 missense probably damaging 1.00
R4904:Sez6 UTSW 11 77975254 missense probably damaging 1.00
R5026:Sez6 UTSW 11 77968989 missense probably damaging 1.00
R5040:Sez6 UTSW 11 77969089 critical splice donor site probably null
R5057:Sez6 UTSW 11 77973153 missense probably damaging 1.00
R5093:Sez6 UTSW 11 77976562 missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77973759 intron probably benign
R6013:Sez6 UTSW 11 77973797 missense probably damaging 1.00
R6126:Sez6 UTSW 11 77973804 missense probably damaging 1.00
R6153:Sez6 UTSW 11 77977822 missense probably damaging 0.99
R6279:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77973844
R6722:Sez6 UTSW 11 77953702 missense probably damaging 1.00
R6897:Sez6 UTSW 11 77953559 missense probably damaging 1.00
R6910:Sez6 UTSW 11 77953869 missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77977795 missense probably benign 0.04
R7233:Sez6 UTSW 11 77973137 missense probably damaging 1.00
R7265:Sez6 UTSW 11 77962865 missense probably damaging 0.96
R7289:Sez6 UTSW 11 77974323 missense possibly damaging 0.96
R7405:Sez6 UTSW 11 77962891 missense probably benign 0.10
R7485:Sez6 UTSW 11 77973885 missense probably benign 0.01
R7592:Sez6 UTSW 11 77978050 missense probably damaging 0.99
R7778:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R7793:Sez6 UTSW 11 77977600 missense probably damaging 1.00
R7818:Sez6 UTSW 11 77976902 missense probably damaging 1.00
R7824:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R8008:Sez6 UTSW 11 77973256 nonsense probably null
X0013:Sez6 UTSW 11 77954780 missense probably benign 0.01
X0067:Sez6 UTSW 11 77974438 critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77973197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGATGGATCTCCTCCTGCCTG -3'
(R):5'- CTGGAGTCGGACTGGTAAAG -3'

Sequencing Primer
(F):5'- CTGGGTGGGATGCTGTTCAC -3'
(R):5'- TAAAGACGGGGCGGTTGTCC -3'
Posted On2019-10-07