Incidental Mutation 'R7408:Pxdn'
ID574864
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R7408 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29990945 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 407 (Y407H)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118321] [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably benign
Transcript: ENSMUST00000118321
SMART Domains Protein: ENSMUSP00000113477
Gene: ENSMUSG00000020674

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122328
AA Change: Y407H

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: Y407H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220271
AA Change: Y227H

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,882,309 F299S probably damaging Het
Arhgap32 A T 9: 32,245,924 E72D probably benign Het
Arid1a G T 4: 133,681,080 Q1654K unknown Het
Atp6v1f A C 6: 29,470,195 H96P probably damaging Het
Cast A G 13: 74,739,841 V161A probably damaging Het
Ccdc186 A T 19: 56,808,178 C320S probably damaging Het
Cgn T A 3: 94,763,055 K1031* probably null Het
Cnot10 T C 9: 114,631,826 N92S probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cstf2t T C 19: 31,083,193 V43A possibly damaging Het
D930020B18Rik T C 10: 121,689,834 L547P probably damaging Het
Dennd1a G A 2: 37,852,172 probably null Het
Dtnb T A 12: 3,644,272 probably null Het
Entpd1 A G 19: 40,738,865 N486D possibly damaging Het
Fes G A 7: 80,378,662 R736C probably damaging Het
Galr1 T G 18: 82,393,865 Y292S probably damaging Het
Gda T A 19: 21,428,624 D80V probably damaging Het
Ghr A G 15: 3,347,572 C56R probably benign Het
Golgb1 A G 16: 36,898,547 T313A probably damaging Het
Gpaa1 A T 15: 76,332,993 D236V probably damaging Het
Gsdmc A G 15: 63,804,466 S43P probably benign Het
Gsdmd A G 15: 75,866,353 E295G probably damaging Het
Htatip2 A G 7: 49,759,786 K96R probably benign Het
Insm1 T A 2: 146,222,791 F176I probably benign Het
Itih1 T C 14: 30,943,160 E36G probably benign Het
Jak1 A G 4: 101,175,182 V409A probably damaging Het
Knl1 A G 2: 119,070,592 I925V possibly damaging Het
Lcmt2 A G 2: 121,138,704 S413P probably benign Het
Lmo7 T C 14: 101,880,953 S205P probably damaging Het
Lrch3 C A 16: 32,986,743 S462* probably null Het
Lrrtm2 T C 18: 35,213,635 I205V possibly damaging Het
Mark3 T G 12: 111,633,789 N479K probably damaging Het
Mrpl19 C T 6: 81,965,812 G39D possibly damaging Het
Msh4 A G 3: 153,876,745 Y497H probably benign Het
Msl2 T A 9: 101,102,117 D563E probably benign Het
Mta1 G A 12: 113,131,468 probably null Het
Nalcn T A 14: 123,291,860 Q1401L probably benign Het
Ncapg T C 5: 45,695,793 L867P probably benign Het
Nkapl T C 13: 21,467,843 D200G unknown Het
Nos1 A C 5: 117,867,518 E101A probably damaging Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Ntng1 A G 3: 109,853,082 I358T probably benign Het
Olfr1270 T A 2: 90,149,844 H54L probably benign Het
Olfr1342 C T 4: 118,689,662 M263I probably damaging Het
Olfr715b A G 7: 107,106,067 S265P probably benign Het
Olfr745 A G 14: 50,642,395 E32G probably benign Het
Olfr794 A G 10: 129,570,624 probably benign Het
Pex1 A G 5: 3,630,222 D948G probably damaging Het
Pkd1l2 A T 8: 117,028,479 I1660N possibly damaging Het
Pkp2 T A 16: 16,261,673 Y540N possibly damaging Het
Pkp4 T C 2: 59,311,766 L471P probably damaging Het
Plekhm3 A T 1: 64,937,984 M109K probably benign Het
Plekhn1 T C 4: 156,233,961 N68S probably benign Het
Pramel7 T A 2: 87,490,845 D282V possibly damaging Het
Rab3ip T C 10: 116,937,641 D89G possibly damaging Het
Rad17 G A 13: 100,629,511 Q370* probably null Het
Robo4 T C 9: 37,410,981 C751R probably benign Het
Sez6 A G 11: 77,953,530 T60A probably damaging Het
Socs4 A G 14: 47,289,839 H77R probably benign Het
Srrm3 T A 5: 135,852,206 M120K probably benign Het
Steap4 A T 5: 7,978,453 I344F probably benign Het
Stk36 T A 1: 74,633,566 F989Y probably damaging Het
Toporsl A T 4: 52,612,108 Q667L probably benign Het
Tspan17 T C 13: 54,789,653 F20S probably benign Het
Tubgcp3 G A 8: 12,661,359 Q65* probably null Het
Ush2a A T 1: 188,733,529 I2765F probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 A G 14: 33,078,307 V1954A Het
Xrn2 T A 2: 147,042,097 probably null Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAATCCAGCCGCAGAAC -3'
(R):5'- GGACAGCTCCTGAAATTGTTCTC -3'

Sequencing Primer
(F):5'- GCCGCAGAACACAGAGGTAC -3'
(R):5'- CATGGACATGTTCTCAGAAGCATGC -3'
Posted On2019-10-07