Incidental Mutation 'R7408:Gda'
ID574887
Institutional Source Beutler Lab
Gene Symbol Gda
Ensembl Gene ENSMUSG00000058624
Gene Nameguanine deaminase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7408 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location21391307-21473445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21428624 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 80 (D80V)
Ref Sequence ENSEMBL: ENSMUSP00000084882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087600] [ENSMUST00000121725]
Predicted Effect probably damaging
Transcript: ENSMUST00000087600
AA Change: D80V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084882
Gene: ENSMUSG00000058624
AA Change: D80V

DomainStartEndE-ValueType
Pfam:Amidohydro_1 73 447 6.8e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121725
AA Change: D6V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112758
Gene: ENSMUSG00000058624
AA Change: D6V

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 327 5.9e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,882,309 F299S probably damaging Het
Arhgap32 A T 9: 32,245,924 E72D probably benign Het
Arid1a G T 4: 133,681,080 Q1654K unknown Het
Atp6v1f A C 6: 29,470,195 H96P probably damaging Het
Cast A G 13: 74,739,841 V161A probably damaging Het
Ccdc186 A T 19: 56,808,178 C320S probably damaging Het
Cgn T A 3: 94,763,055 K1031* probably null Het
Cnot10 T C 9: 114,631,826 N92S probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cstf2t T C 19: 31,083,193 V43A possibly damaging Het
D930020B18Rik T C 10: 121,689,834 L547P probably damaging Het
Dennd1a G A 2: 37,852,172 probably null Het
Dtnb T A 12: 3,644,272 probably null Het
Entpd1 A G 19: 40,738,865 N486D possibly damaging Het
Fes G A 7: 80,378,662 R736C probably damaging Het
Galr1 T G 18: 82,393,865 Y292S probably damaging Het
Ghr A G 15: 3,347,572 C56R probably benign Het
Golgb1 A G 16: 36,898,547 T313A probably damaging Het
Gpaa1 A T 15: 76,332,993 D236V probably damaging Het
Gsdmc A G 15: 63,804,466 S43P probably benign Het
Gsdmd A G 15: 75,866,353 E295G probably damaging Het
Htatip2 A G 7: 49,759,786 K96R probably benign Het
Insm1 T A 2: 146,222,791 F176I probably benign Het
Itih1 T C 14: 30,943,160 E36G probably benign Het
Jak1 A G 4: 101,175,182 V409A probably damaging Het
Knl1 A G 2: 119,070,592 I925V possibly damaging Het
Lcmt2 A G 2: 121,138,704 S413P probably benign Het
Lmo7 T C 14: 101,880,953 S205P probably damaging Het
Lrch3 C A 16: 32,986,743 S462* probably null Het
Lrrtm2 T C 18: 35,213,635 I205V possibly damaging Het
Mark3 T G 12: 111,633,789 N479K probably damaging Het
Mrpl19 C T 6: 81,965,812 G39D possibly damaging Het
Msh4 A G 3: 153,876,745 Y497H probably benign Het
Msl2 T A 9: 101,102,117 D563E probably benign Het
Mta1 G A 12: 113,131,468 probably null Het
Nalcn T A 14: 123,291,860 Q1401L probably benign Het
Ncapg T C 5: 45,695,793 L867P probably benign Het
Nkapl T C 13: 21,467,843 D200G unknown Het
Nos1 A C 5: 117,867,518 E101A probably damaging Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Ntng1 A G 3: 109,853,082 I358T probably benign Het
Olfr1270 T A 2: 90,149,844 H54L probably benign Het
Olfr1342 C T 4: 118,689,662 M263I probably damaging Het
Olfr715b A G 7: 107,106,067 S265P probably benign Het
Olfr745 A G 14: 50,642,395 E32G probably benign Het
Olfr794 A G 10: 129,570,624 probably benign Het
Pex1 A G 5: 3,630,222 D948G probably damaging Het
Pkd1l2 A T 8: 117,028,479 I1660N possibly damaging Het
Pkp2 T A 16: 16,261,673 Y540N possibly damaging Het
Pkp4 T C 2: 59,311,766 L471P probably damaging Het
Plekhm3 A T 1: 64,937,984 M109K probably benign Het
Plekhn1 T C 4: 156,233,961 N68S probably benign Het
Pramel7 T A 2: 87,490,845 D282V possibly damaging Het
Pxdn T C 12: 29,990,945 Y407H probably benign Het
Rab3ip T C 10: 116,937,641 D89G possibly damaging Het
Rad17 G A 13: 100,629,511 Q370* probably null Het
Robo4 T C 9: 37,410,981 C751R probably benign Het
Sez6 A G 11: 77,953,530 T60A probably damaging Het
Socs4 A G 14: 47,289,839 H77R probably benign Het
Srrm3 T A 5: 135,852,206 M120K probably benign Het
Steap4 A T 5: 7,978,453 I344F probably benign Het
Stk36 T A 1: 74,633,566 F989Y probably damaging Het
Toporsl A T 4: 52,612,108 Q667L probably benign Het
Tspan17 T C 13: 54,789,653 F20S probably benign Het
Tubgcp3 G A 8: 12,661,359 Q65* probably null Het
Ush2a A T 1: 188,733,529 I2765F probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 A G 14: 33,078,307 V1954A Het
Xrn2 T A 2: 147,042,097 probably null Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Gda
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Gda APN 19 21417065 missense probably damaging 1.00
IGL01324:Gda APN 19 21409886 missense probably damaging 0.98
IGL02814:Gda APN 19 21428475 splice site probably null
IGL03037:Gda APN 19 21434309 missense possibly damaging 0.89
IGL03274:Gda APN 19 21417007 missense possibly damaging 0.88
R0106:Gda UTSW 19 21397556 missense probably benign 0.02
R0106:Gda UTSW 19 21397556 missense probably benign 0.02
R0312:Gda UTSW 19 21417005 missense probably damaging 1.00
R0432:Gda UTSW 19 21417107 missense probably damaging 0.98
R0529:Gda UTSW 19 21425537 missense probably damaging 1.00
R0600:Gda UTSW 19 21434303 missense possibly damaging 0.70
R0690:Gda UTSW 19 21409887 missense probably benign
R1522:Gda UTSW 19 21412539 missense probably benign
R1652:Gda UTSW 19 21400678 missense probably damaging 0.99
R1917:Gda UTSW 19 21397640 splice site probably benign
R2078:Gda UTSW 19 21400672 missense probably damaging 1.00
R2153:Gda UTSW 19 21397505 critical splice donor site probably null
R3951:Gda UTSW 19 21472445 missense probably benign 0.27
R4707:Gda UTSW 19 21428628 missense probably benign 0.00
R5554:Gda UTSW 19 21428473 splice site probably null
R5620:Gda UTSW 19 21397544 missense probably damaging 1.00
R7186:Gda UTSW 19 21395205 missense probably benign 0.12
R7386:Gda UTSW 19 21409886 missense probably benign 0.04
R8315:Gda UTSW 19 21417071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTACACAGGACAGGCAC -3'
(R):5'- CTACAGTGGCTTGGCTTCTG -3'

Sequencing Primer
(F):5'- GGACAGGCACACAGAATACTC -3'
(R):5'- ACTGTCTCTGATTGGAACTGTAC -3'
Posted On2019-10-07