Incidental Mutation 'R7409:Ap4b1'
ID 574905
Institutional Source Beutler Lab
Gene Symbol Ap4b1
Ensembl Gene ENSMUSG00000032952
Gene Name adaptor-related protein complex AP-4, beta 1
Synonyms AP-4 beta-4, 1810038H16Rik
MMRRC Submission 045490-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R7409 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103716836-103729341 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103719474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000044262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000047285] [ENSMUST00000063502] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000198752] [ENSMUST00000199710] [ENSMUST00000200377]
AlphaFold Q9WV76
Predicted Effect probably benign
Transcript: ENSMUST00000029435
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000047285
AA Change: V63I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063502
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000076599
AA Change: V63I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106823
AA Change: V63I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106824
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106832
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106834
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128716
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198752
SMART Domains Protein: ENSMUSP00000143067
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 93 2e-64 BLAST
PDB:3ZDK|A 1 97 1e-62 PDB
SCOP:d1a7ta_ 3 93 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199686
Predicted Effect probably benign
Transcript: ENSMUST00000199710
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200377
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans-Golgi network to the endosomal-lysosomal system. Mutations in this gene are associated with cerebral palsy spastic quadriplegic type 5 (CPSQ5) disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit poor rotarod performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 C T 4: 129,912,862 (GRCm39) A1329V probably benign Het
Aida A G 1: 183,099,809 (GRCm39) T215A probably benign Het
Alpk2 A G 18: 65,440,023 (GRCm39) S457P probably benign Het
Apaf1 A G 10: 90,903,108 (GRCm39) V182A probably damaging Het
B4galnt4 G A 7: 140,646,916 (GRCm39) probably null Het
Bltp2 G T 11: 78,159,583 (GRCm39) R544L probably damaging Het
Cacna1a T G 8: 85,260,031 (GRCm39) D331E probably damaging Het
Carmil2 A G 8: 106,419,423 (GRCm39) probably null Het
Cdkn1b A T 6: 134,898,280 (GRCm39) Q133L probably benign Het
Cep192 G C 18: 67,967,874 (GRCm39) S786T possibly damaging Het
Cfap418 T A 4: 10,881,834 (GRCm39) C94S probably benign Het
Cfap97 G A 8: 46,645,733 (GRCm39) R537H probably benign Het
Clpx C G 9: 65,231,529 (GRCm39) A552G possibly damaging Het
Cryl1 G A 14: 57,523,842 (GRCm39) T240I probably damaging Het
Ddx60 C A 8: 62,411,612 (GRCm39) T488K probably benign Het
Dennd4b A G 3: 90,181,259 (GRCm39) H805R probably benign Het
Dnmbp T C 19: 43,878,996 (GRCm39) D25G unknown Het
Dysf A C 6: 84,126,664 (GRCm39) D1293A probably benign Het
Efl1 T C 7: 82,347,121 (GRCm39) L549P probably damaging Het
Eif5 T C 12: 111,506,697 (GRCm39) probably benign Het
Eva1c A G 16: 90,666,544 (GRCm39) K156E probably damaging Het
Fbxw10 T G 11: 62,767,606 (GRCm39) V814G possibly damaging Het
Gfap C T 11: 102,785,358 (GRCm39) R206Q probably benign Het
Gjb6 A T 14: 57,361,610 (GRCm39) L217* probably null Het
Gpatch11 T A 17: 79,146,595 (GRCm39) L80Q probably damaging Het
Gramd1b T C 9: 40,238,727 (GRCm39) Q225R probably damaging Het
Gsdmc2 A G 15: 63,705,195 (GRCm39) S173P possibly damaging Het
Hars1 C G 18: 36,903,166 (GRCm39) R388P probably damaging Het
Ighm C T 12: 113,385,852 (GRCm39) R129H Het
Igsf9 A G 1: 172,322,841 (GRCm39) I602V probably benign Het
Inpp4b T G 8: 82,679,314 (GRCm39) probably null Het
Itch C A 2: 155,041,302 (GRCm39) T450K probably damaging Het
Kcnq1 T C 7: 142,663,152 (GRCm39) F20L unknown Het
Kmt2d G T 15: 98,753,235 (GRCm39) A153E probably damaging Het
Macf1 T A 4: 123,398,263 (GRCm39) N750I probably damaging Het
Marveld2 T A 13: 100,747,984 (GRCm39) H365L probably damaging Het
Med13l T A 5: 118,892,386 (GRCm39) D1936E probably benign Het
Mettl8 A T 2: 70,803,687 (GRCm39) V200E probably damaging Het
Mrgbp T G 2: 180,227,135 (GRCm39) S157A possibly damaging Het
Mrps35 A G 6: 146,957,481 (GRCm39) T169A possibly damaging Het
Mycbp2 A T 14: 103,526,180 (GRCm39) Y551N probably damaging Het
Myo18b T C 5: 113,021,971 (GRCm39) R474G probably benign Het
Nfx1 T A 4: 41,021,830 (GRCm39) S979R possibly damaging Het
Nlrp1a T C 11: 71,013,634 (GRCm39) T539A probably benign Het
Oca2 T A 7: 56,064,145 (GRCm39) D713E probably benign Het
Omt2b A C 9: 78,235,894 (GRCm39) Y73S probably benign Het
Or10aa1 T A 1: 173,870,099 (GRCm39) H194Q probably benign Het
Or13a27 C T 7: 139,925,318 (GRCm39) V195I probably benign Het
Or6c38 A G 10: 128,929,081 (GRCm39) I254T probably damaging Het
Or6c69 A T 10: 129,748,120 (GRCm39) V9D possibly damaging Het
Pde11a G T 2: 75,836,328 (GRCm39) Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Phrf1 C A 7: 140,839,205 (GRCm39) T800K unknown Het
Polr1f T G 12: 33,486,988 (GRCm39) C150W possibly damaging Het
Pramel4 T C 4: 143,795,061 (GRCm39) S486P probably benign Het
Proc T C 18: 32,260,513 (GRCm39) D204G probably benign Het
Rasgrp3 T A 17: 75,823,411 (GRCm39) I494N possibly damaging Het
Samm50 A G 15: 84,081,231 (GRCm39) D53G probably benign Het
Satb1 T C 17: 52,116,217 (GRCm39) D22G possibly damaging Het
Scarf2 T C 16: 17,624,918 (GRCm39) S658P probably damaging Het
Sfta2 T A 17: 35,925,410 (GRCm39) I29K unknown Het
Slc15a4 A T 5: 127,681,742 (GRCm39) S292T probably benign Het
Slc37a1 C T 17: 31,559,237 (GRCm39) T439I probably damaging Het
Slc4a9 C A 18: 36,663,858 (GRCm39) P294Q probably damaging Het
Slc52a3 T C 2: 151,846,086 (GRCm39) S16P probably damaging Het
Slc6a15 A G 10: 103,244,163 (GRCm39) I468V probably benign Het
Spag17 T C 3: 99,934,547 (GRCm39) S610P possibly damaging Het
Spag17 A T 3: 99,941,475 (GRCm39) D738V probably benign Het
Ssbp4 T C 8: 71,050,617 (GRCm39) R269G unknown Het
Tbl1xr1 A G 3: 22,257,354 (GRCm39) T406A possibly damaging Het
Tep1 A T 14: 51,104,312 (GRCm39) V194D possibly damaging Het
Thbs4 A T 13: 92,909,767 (GRCm39) C343* probably null Het
Tmed10 A T 12: 85,391,065 (GRCm39) S158T possibly damaging Het
Trbv3 T A 6: 41,025,524 (GRCm39) V38E probably damaging Het
Ttc6 T C 12: 57,743,772 (GRCm39) M1258T probably damaging Het
Ttn T C 2: 76,589,320 (GRCm39) D21281G probably damaging Het
Usp54 T C 14: 20,602,313 (GRCm39) R1346G probably damaging Het
Vmn2r8 C A 5: 108,956,449 (GRCm39) E58* probably null Het
Vps13d C T 4: 144,867,824 (GRCm39) E2009K Het
Vps33b T C 7: 79,935,017 (GRCm39) I320T probably damaging Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Ythdf1 T C 2: 180,553,786 (GRCm39) Y143C probably damaging Het
Zfp213 C T 17: 23,778,603 (GRCm39) probably null Het
Zfp219 A T 14: 52,244,570 (GRCm39) Y536* probably null Het
Other mutations in Ap4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ap4b1 APN 3 103,728,858 (GRCm39) missense probably benign 0.19
IGL01545:Ap4b1 APN 3 103,720,143 (GRCm39) missense probably benign 0.02
IGL02422:Ap4b1 APN 3 103,720,170 (GRCm39) missense possibly damaging 0.95
IGL02525:Ap4b1 APN 3 103,720,164 (GRCm39) missense probably damaging 1.00
R0035:Ap4b1 UTSW 3 103,727,980 (GRCm39) splice site probably benign
R0035:Ap4b1 UTSW 3 103,727,980 (GRCm39) splice site probably benign
R0086:Ap4b1 UTSW 3 103,722,176 (GRCm39) missense probably damaging 0.99
R0090:Ap4b1 UTSW 3 103,727,745 (GRCm39) missense possibly damaging 0.91
R0136:Ap4b1 UTSW 3 103,717,262 (GRCm39) start codon destroyed probably null 1.00
R0299:Ap4b1 UTSW 3 103,717,262 (GRCm39) start codon destroyed probably null 1.00
R0403:Ap4b1 UTSW 3 103,728,712 (GRCm39) missense probably benign 0.00
R0403:Ap4b1 UTSW 3 103,726,155 (GRCm39) missense probably damaging 0.99
R1283:Ap4b1 UTSW 3 103,726,177 (GRCm39) missense probably damaging 1.00
R1673:Ap4b1 UTSW 3 103,725,161 (GRCm39) critical splice donor site probably null
R1797:Ap4b1 UTSW 3 103,726,149 (GRCm39) missense possibly damaging 0.92
R1869:Ap4b1 UTSW 3 103,728,184 (GRCm39) nonsense probably null
R2925:Ap4b1 UTSW 3 103,727,997 (GRCm39) missense probably damaging 1.00
R3905:Ap4b1 UTSW 3 103,726,209 (GRCm39) missense possibly damaging 0.94
R4079:Ap4b1 UTSW 3 103,720,694 (GRCm39) missense probably damaging 1.00
R4645:Ap4b1 UTSW 3 103,728,765 (GRCm39) missense probably benign 0.32
R4786:Ap4b1 UTSW 3 103,726,120 (GRCm39) missense probably benign 0.00
R5824:Ap4b1 UTSW 3 103,720,701 (GRCm39) missense probably benign 0.30
R6342:Ap4b1 UTSW 3 103,720,684 (GRCm39) missense possibly damaging 0.60
R6826:Ap4b1 UTSW 3 103,720,224 (GRCm39) critical splice donor site probably null
R6923:Ap4b1 UTSW 3 103,719,530 (GRCm39) missense probably benign 0.19
R6974:Ap4b1 UTSW 3 103,720,601 (GRCm39) nonsense probably null
R7827:Ap4b1 UTSW 3 103,722,398 (GRCm39) missense probably damaging 1.00
R8432:Ap4b1 UTSW 3 103,728,135 (GRCm39) missense probably benign 0.00
R8499:Ap4b1 UTSW 3 103,728,018 (GRCm39) missense probably damaging 0.98
R8504:Ap4b1 UTSW 3 103,720,116 (GRCm39) missense probably damaging 0.99
R8897:Ap4b1 UTSW 3 103,729,065 (GRCm39) missense probably benign
R9138:Ap4b1 UTSW 3 103,722,626 (GRCm39) missense probably damaging 1.00
R9283:Ap4b1 UTSW 3 103,722,259 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAGTTGCAGACTCTTAATAGGAAG -3'
(R):5'- AGGGTATCGAAGCACTCACC -3'

Sequencing Primer
(F):5'- CTCTAAAAGCTCATAGTTTGGCTAGC -3'
(R):5'- CTGAGGCTACACATACTCCGTAGTG -3'
Posted On 2019-10-07