Incidental Mutation 'R7409:Cfap97'
ID574927
Institutional Source Beutler Lab
Gene Symbol Cfap97
Ensembl Gene ENSMUSG00000031631
Gene Namecilia and flagella associated protein 97
Synonyms4933411K20Rik, 1110068E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7409 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location46151771-46195590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46192696 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 537 (R537H)
Ref Sequence ENSEMBL: ENSMUSP00000034048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034048] [ENSMUST00000110376] [ENSMUST00000164504]
Predicted Effect probably benign
Transcript: ENSMUST00000034048
AA Change: R537H

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034048
Gene: ENSMUSG00000031631
AA Change: R537H

DomainStartEndE-ValueType
low complexity region 113 126 N/A INTRINSIC
low complexity region 176 201 N/A INTRINSIC
low complexity region 287 294 N/A INTRINSIC
Pfam:KIAA1430 352 457 4.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110376
SMART Domains Protein: ENSMUSP00000106005
Gene: ENSMUSG00000031631

DomainStartEndE-ValueType
low complexity region 113 126 N/A INTRINSIC
low complexity region 176 201 N/A INTRINSIC
low complexity region 287 294 N/A INTRINSIC
Pfam:KIAA1430 353 456 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164504
AA Change: R537H

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133211
Gene: ENSMUSG00000031631
AA Change: R537H

DomainStartEndE-ValueType
low complexity region 113 126 N/A INTRINSIC
low complexity region 176 201 N/A INTRINSIC
low complexity region 287 294 N/A INTRINSIC
Pfam:KIAA1430 352 457 4.4e-21 PFAM
Meta Mutation Damage Score 0.1463 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,881,834 C94S probably benign Het
2610507B11Rik G T 11: 78,268,757 R544L probably damaging Het
Adgrb2 C T 4: 130,019,069 A1329V probably benign Het
Aida A G 1: 183,318,874 T215A probably benign Het
Alpk2 A G 18: 65,306,952 S457P probably benign Het
Ap4b1 G A 3: 103,812,158 V63I probably damaging Het
Apaf1 A G 10: 91,067,246 V182A probably damaging Het
B4galnt4 G A 7: 141,067,003 probably null Het
Cacna1a T G 8: 84,533,402 D331E probably damaging Het
Carmil2 A G 8: 105,692,791 probably null Het
Cdkn1b A T 6: 134,921,317 Q133L probably benign Het
Cep192 G C 18: 67,834,803 S786T possibly damaging Het
Clpx C G 9: 65,324,247 A552G possibly damaging Het
Cryl1 G A 14: 57,286,385 T240I probably damaging Het
Ddx60 C A 8: 61,958,578 T488K probably benign Het
Dennd4b A G 3: 90,273,952 H805R probably benign Het
Dnmbp T C 19: 43,890,557 D25G unknown Het
Dysf A C 6: 84,149,682 D1293A probably benign Het
Efl1 T C 7: 82,697,913 L549P probably damaging Het
Eif5 T C 12: 111,540,263 probably benign Het
Eva1c A G 16: 90,869,656 K156E probably damaging Het
Fbxw10 T G 11: 62,876,780 V814G possibly damaging Het
Gfap C T 11: 102,894,532 R206Q probably benign Het
Gjb6 A T 14: 57,124,153 L217* probably null Het
Gpatch11 T A 17: 78,839,166 L80Q probably damaging Het
Gramd1b T C 9: 40,327,431 Q225R probably damaging Het
Gsdmc2 A G 15: 63,833,346 S173P possibly damaging Het
Hars C G 18: 36,770,113 R388P probably damaging Het
Ighm C T 12: 113,422,232 R129H Het
Igsf9 A G 1: 172,495,274 I602V probably benign Het
Inpp4b T G 8: 81,952,685 probably null Het
Itch C A 2: 155,199,382 T450K probably damaging Het
Kcnq1 T C 7: 143,109,415 F20L unknown Het
Kmt2d G T 15: 98,855,354 A153E probably damaging Het
Macf1 T A 4: 123,504,470 N750I probably damaging Het
Marveld2 T A 13: 100,611,476 H365L probably damaging Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mettl8 A T 2: 70,973,343 V200E probably damaging Het
Mrgbp T G 2: 180,585,342 S157A possibly damaging Het
Mrps35 A G 6: 147,055,983 T169A possibly damaging Het
Mycbp2 A T 14: 103,288,744 Y551N probably damaging Het
Myo18b T C 5: 112,874,105 R474G probably benign Het
Nfx1 T A 4: 41,021,830 S979R possibly damaging Het
Nlrp1a T C 11: 71,122,808 T539A probably benign Het
Oca2 T A 7: 56,414,397 D713E probably benign Het
Olfr433 T A 1: 174,042,533 H194Q probably benign Het
Olfr60 C T 7: 140,345,405 V195I probably benign Het
Olfr768 A G 10: 129,093,212 I254T probably damaging Het
Olfr816 A T 10: 129,912,251 V9D possibly damaging Het
Omt2b A C 9: 78,328,612 Y73S probably benign Het
Pde11a G T 2: 76,005,984 Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phrf1 C A 7: 141,259,292 T800K unknown Het
Pramel4 T C 4: 144,068,491 S486P probably benign Het
Proc T C 18: 32,127,460 D204G probably benign Het
Rasgrp3 T A 17: 75,516,416 I494N possibly damaging Het
Samm50 A G 15: 84,197,030 D53G probably benign Het
Satb1 T C 17: 51,809,189 D22G possibly damaging Het
Scarf2 T C 16: 17,807,054 S658P probably damaging Het
Sfta2 T A 17: 35,614,518 I29K unknown Het
Slc15a4 A T 5: 127,604,678 S292T probably benign Het
Slc37a1 C T 17: 31,340,263 T439I probably damaging Het
Slc4a9 C A 18: 36,530,805 P294Q probably damaging Het
Slc52a3 T C 2: 152,004,166 S16P probably damaging Het
Slc6a15 A G 10: 103,408,302 I468V probably benign Het
Spag17 T C 3: 100,027,231 S610P possibly damaging Het
Spag17 A T 3: 100,034,159 D738V probably benign Het
Ssbp4 T C 8: 70,597,967 R269G unknown Het
Tbl1xr1 A G 3: 22,203,190 T406A possibly damaging Het
Tep1 A T 14: 50,866,855 V194D possibly damaging Het
Thbs4 A T 13: 92,773,259 C343* probably null Het
Tmed10 A T 12: 85,344,291 S158T possibly damaging Het
Trbv3 T A 6: 41,048,590 V38E probably damaging Het
Ttc6 T C 12: 57,696,986 M1258T probably damaging Het
Ttn T C 2: 76,758,976 D21281G probably damaging Het
Twistnb T G 12: 33,436,989 C150W possibly damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn2r8 C A 5: 108,808,583 E58* probably null Het
Vps13d C T 4: 145,141,254 E2009K Het
Vps33b T C 7: 80,285,269 I320T probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Ythdf1 T C 2: 180,911,993 Y143C probably damaging Het
Zfp213 C T 17: 23,559,629 probably null Het
Zfp219 A T 14: 52,007,113 Y536* probably null Het
Other mutations in Cfap97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Cfap97 APN 8 46170185 missense probably damaging 1.00
IGL01335:Cfap97 APN 8 46170455 missense probably damaging 1.00
IGL02327:Cfap97 APN 8 46170142 missense probably damaging 1.00
IGL02457:Cfap97 APN 8 46170278 missense possibly damaging 0.63
R4289:Cfap97 UTSW 8 46192661 missense probably benign 0.03
R4777:Cfap97 UTSW 8 46195297 nonsense probably null
R4844:Cfap97 UTSW 8 46169675 missense possibly damaging 0.85
R5369:Cfap97 UTSW 8 46169650 missense probably damaging 1.00
R5574:Cfap97 UTSW 8 46170142 missense probably damaging 1.00
R5914:Cfap97 UTSW 8 46181858 missense probably damaging 0.97
R6227:Cfap97 UTSW 8 46191732 critical splice donor site probably null
R6790:Cfap97 UTSW 8 46170076 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACTTGATCAGATGAGGACCTGTG -3'
(R):5'- CACCACTGCTGCTTTGTCAG -3'

Sequencing Primer
(F):5'- GACCTGTGTACTTGATTCAGATAGC -3'
(R):5'- CACTGATTTTACAGCAAGGTGTC -3'
Posted On2019-10-07