Incidental Mutation 'R7409:Slc6a15'
ID574935
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 15
Synonymsv7-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7409 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location103367783-103419377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103408302 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 468 (I468V)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
Predicted Effect probably benign
Transcript: ENSMUST00000074204
AA Change: I468V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: I468V

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179636
AA Change: I468V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: I468V

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,881,834 C94S probably benign Het
2610507B11Rik G T 11: 78,268,757 R544L probably damaging Het
Adgrb2 C T 4: 130,019,069 A1329V probably benign Het
Aida A G 1: 183,318,874 T215A probably benign Het
Alpk2 A G 18: 65,306,952 S457P probably benign Het
Ap4b1 G A 3: 103,812,158 V63I probably damaging Het
Apaf1 A G 10: 91,067,246 V182A probably damaging Het
B4galnt4 G A 7: 141,067,003 probably null Het
Cacna1a T G 8: 84,533,402 D331E probably damaging Het
Carmil2 A G 8: 105,692,791 probably null Het
Cdkn1b A T 6: 134,921,317 Q133L probably benign Het
Cep192 G C 18: 67,834,803 S786T possibly damaging Het
Cfap97 G A 8: 46,192,696 R537H probably benign Het
Clpx C G 9: 65,324,247 A552G possibly damaging Het
Cryl1 G A 14: 57,286,385 T240I probably damaging Het
Ddx60 C A 8: 61,958,578 T488K probably benign Het
Dennd4b A G 3: 90,273,952 H805R probably benign Het
Dnmbp T C 19: 43,890,557 D25G unknown Het
Dysf A C 6: 84,149,682 D1293A probably benign Het
Efl1 T C 7: 82,697,913 L549P probably damaging Het
Eif5 T C 12: 111,540,263 probably benign Het
Eva1c A G 16: 90,869,656 K156E probably damaging Het
Fbxw10 T G 11: 62,876,780 V814G possibly damaging Het
Gfap C T 11: 102,894,532 R206Q probably benign Het
Gjb6 A T 14: 57,124,153 L217* probably null Het
Gpatch11 T A 17: 78,839,166 L80Q probably damaging Het
Gramd1b T C 9: 40,327,431 Q225R probably damaging Het
Gsdmc2 A G 15: 63,833,346 S173P possibly damaging Het
Hars C G 18: 36,770,113 R388P probably damaging Het
Ighm C T 12: 113,422,232 R129H Het
Igsf9 A G 1: 172,495,274 I602V probably benign Het
Inpp4b T G 8: 81,952,685 probably null Het
Itch C A 2: 155,199,382 T450K probably damaging Het
Kcnq1 T C 7: 143,109,415 F20L unknown Het
Kmt2d G T 15: 98,855,354 A153E probably damaging Het
Macf1 T A 4: 123,504,470 N750I probably damaging Het
Marveld2 T A 13: 100,611,476 H365L probably damaging Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mettl8 A T 2: 70,973,343 V200E probably damaging Het
Mrgbp T G 2: 180,585,342 S157A possibly damaging Het
Mrps35 A G 6: 147,055,983 T169A possibly damaging Het
Mycbp2 A T 14: 103,288,744 Y551N probably damaging Het
Myo18b T C 5: 112,874,105 R474G probably benign Het
Nfx1 T A 4: 41,021,830 S979R possibly damaging Het
Nlrp1a T C 11: 71,122,808 T539A probably benign Het
Oca2 T A 7: 56,414,397 D713E probably benign Het
Olfr433 T A 1: 174,042,533 H194Q probably benign Het
Olfr60 C T 7: 140,345,405 V195I probably benign Het
Olfr768 A G 10: 129,093,212 I254T probably damaging Het
Olfr816 A T 10: 129,912,251 V9D possibly damaging Het
Omt2b A C 9: 78,328,612 Y73S probably benign Het
Pde11a G T 2: 76,005,984 Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phrf1 C A 7: 141,259,292 T800K unknown Het
Pramel4 T C 4: 144,068,491 S486P probably benign Het
Proc T C 18: 32,127,460 D204G probably benign Het
Rasgrp3 T A 17: 75,516,416 I494N possibly damaging Het
Samm50 A G 15: 84,197,030 D53G probably benign Het
Satb1 T C 17: 51,809,189 D22G possibly damaging Het
Scarf2 T C 16: 17,807,054 S658P probably damaging Het
Sfta2 T A 17: 35,614,518 I29K unknown Het
Slc15a4 A T 5: 127,604,678 S292T probably benign Het
Slc37a1 C T 17: 31,340,263 T439I probably damaging Het
Slc4a9 C A 18: 36,530,805 P294Q probably damaging Het
Slc52a3 T C 2: 152,004,166 S16P probably damaging Het
Spag17 T C 3: 100,027,231 S610P possibly damaging Het
Spag17 A T 3: 100,034,159 D738V probably benign Het
Ssbp4 T C 8: 70,597,967 R269G unknown Het
Tbl1xr1 A G 3: 22,203,190 T406A possibly damaging Het
Tep1 A T 14: 50,866,855 V194D possibly damaging Het
Thbs4 A T 13: 92,773,259 C343* probably null Het
Tmed10 A T 12: 85,344,291 S158T possibly damaging Het
Trbv3 T A 6: 41,048,590 V38E probably damaging Het
Ttc6 T C 12: 57,696,986 M1258T probably damaging Het
Ttn T C 2: 76,758,976 D21281G probably damaging Het
Twistnb T G 12: 33,436,989 C150W possibly damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn2r8 C A 5: 108,808,583 E58* probably null Het
Vps13d C T 4: 145,141,254 E2009K Het
Vps33b T C 7: 80,285,269 I320T probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Ythdf1 T C 2: 180,911,993 Y143C probably damaging Het
Zfp213 C T 17: 23,559,629 probably null Het
Zfp219 A T 14: 52,007,113 Y536* probably null Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103418387 missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5320:Slc6a15 UTSW 10 103408206 missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103404367 missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R7922:Slc6a15 UTSW 10 103404799 missense probably benign
R7948:Slc6a15 UTSW 10 103404295 missense possibly damaging 0.95
RF013:Slc6a15 UTSW 10 103400216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATAAAGCGTATCTTGGCGTATTTC -3'
(R):5'- TAACACAGTCCAATTGCAGTCTC -3'

Sequencing Primer
(F):5'- GCGTATTTCTTTGCAGCAGC -3'
(R):5'- CAGTCCAATTGCAGTCTCTAATATC -3'
Posted On2019-10-07