Incidental Mutation 'R7409:Tmed10'
ID574944
Institutional Source Beutler Lab
Gene Symbol Tmed10
Ensembl Gene ENSMUSG00000021248
Gene Nametransmembrane p24 trafficking protein 10
Synonymsp24delta1, p23, 1110014C03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7409 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location85340614-85374847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85344291 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 158 (S158T)
Ref Sequence ENSEMBL: ENSMUSP00000037583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040766] [ENSMUST00000040992] [ENSMUST00000222585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040766
AA Change: S158T

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037583
Gene: ENSMUSG00000021248
AA Change: S158T

DomainStartEndE-ValueType
EMP24_GP25L 31 213 3.4e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040992
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222585
AA Change: S55T

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. Heterozygous mice display abnormalities of the Golgi apparatus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,881,834 C94S probably benign Het
2610507B11Rik G T 11: 78,268,757 R544L probably damaging Het
Adgrb2 C T 4: 130,019,069 A1329V probably benign Het
Aida A G 1: 183,318,874 T215A probably benign Het
Alpk2 A G 18: 65,306,952 S457P probably benign Het
Ap4b1 G A 3: 103,812,158 V63I probably damaging Het
Apaf1 A G 10: 91,067,246 V182A probably damaging Het
B4galnt4 G A 7: 141,067,003 probably null Het
Cacna1a T G 8: 84,533,402 D331E probably damaging Het
Carmil2 A G 8: 105,692,791 probably null Het
Cdkn1b A T 6: 134,921,317 Q133L probably benign Het
Cep192 G C 18: 67,834,803 S786T possibly damaging Het
Cfap97 G A 8: 46,192,696 R537H probably benign Het
Clpx C G 9: 65,324,247 A552G possibly damaging Het
Cryl1 G A 14: 57,286,385 T240I probably damaging Het
Ddx60 C A 8: 61,958,578 T488K probably benign Het
Dennd4b A G 3: 90,273,952 H805R probably benign Het
Dnmbp T C 19: 43,890,557 D25G unknown Het
Dysf A C 6: 84,149,682 D1293A probably benign Het
Efl1 T C 7: 82,697,913 L549P probably damaging Het
Eif5 T C 12: 111,540,263 probably benign Het
Eva1c A G 16: 90,869,656 K156E probably damaging Het
Fbxw10 T G 11: 62,876,780 V814G possibly damaging Het
Gfap C T 11: 102,894,532 R206Q probably benign Het
Gjb6 A T 14: 57,124,153 L217* probably null Het
Gpatch11 T A 17: 78,839,166 L80Q probably damaging Het
Gramd1b T C 9: 40,327,431 Q225R probably damaging Het
Gsdmc2 A G 15: 63,833,346 S173P possibly damaging Het
Hars C G 18: 36,770,113 R388P probably damaging Het
Ighm C T 12: 113,422,232 R129H Het
Igsf9 A G 1: 172,495,274 I602V probably benign Het
Inpp4b T G 8: 81,952,685 probably null Het
Itch C A 2: 155,199,382 T450K probably damaging Het
Kcnq1 T C 7: 143,109,415 F20L unknown Het
Kmt2d G T 15: 98,855,354 A153E probably damaging Het
Macf1 T A 4: 123,504,470 N750I probably damaging Het
Marveld2 T A 13: 100,611,476 H365L probably damaging Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mettl8 A T 2: 70,973,343 V200E probably damaging Het
Mrgbp T G 2: 180,585,342 S157A possibly damaging Het
Mrps35 A G 6: 147,055,983 T169A possibly damaging Het
Mycbp2 A T 14: 103,288,744 Y551N probably damaging Het
Myo18b T C 5: 112,874,105 R474G probably benign Het
Nfx1 T A 4: 41,021,830 S979R possibly damaging Het
Nlrp1a T C 11: 71,122,808 T539A probably benign Het
Oca2 T A 7: 56,414,397 D713E probably benign Het
Olfr433 T A 1: 174,042,533 H194Q probably benign Het
Olfr60 C T 7: 140,345,405 V195I probably benign Het
Olfr768 A G 10: 129,093,212 I254T probably damaging Het
Olfr816 A T 10: 129,912,251 V9D possibly damaging Het
Omt2b A C 9: 78,328,612 Y73S probably benign Het
Pde11a G T 2: 76,005,984 Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phrf1 C A 7: 141,259,292 T800K unknown Het
Pramel4 T C 4: 144,068,491 S486P probably benign Het
Proc T C 18: 32,127,460 D204G probably benign Het
Rasgrp3 T A 17: 75,516,416 I494N possibly damaging Het
Samm50 A G 15: 84,197,030 D53G probably benign Het
Satb1 T C 17: 51,809,189 D22G possibly damaging Het
Scarf2 T C 16: 17,807,054 S658P probably damaging Het
Sfta2 T A 17: 35,614,518 I29K unknown Het
Slc15a4 A T 5: 127,604,678 S292T probably benign Het
Slc37a1 C T 17: 31,340,263 T439I probably damaging Het
Slc4a9 C A 18: 36,530,805 P294Q probably damaging Het
Slc52a3 T C 2: 152,004,166 S16P probably damaging Het
Slc6a15 A G 10: 103,408,302 I468V probably benign Het
Spag17 T C 3: 100,027,231 S610P possibly damaging Het
Spag17 A T 3: 100,034,159 D738V probably benign Het
Ssbp4 T C 8: 70,597,967 R269G unknown Het
Tbl1xr1 A G 3: 22,203,190 T406A possibly damaging Het
Tep1 A T 14: 50,866,855 V194D possibly damaging Het
Thbs4 A T 13: 92,773,259 C343* probably null Het
Trbv3 T A 6: 41,048,590 V38E probably damaging Het
Ttc6 T C 12: 57,696,986 M1258T probably damaging Het
Ttn T C 2: 76,758,976 D21281G probably damaging Het
Twistnb T G 12: 33,436,989 C150W possibly damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn2r8 C A 5: 108,808,583 E58* probably null Het
Vps13d C T 4: 145,141,254 E2009K Het
Vps33b T C 7: 80,285,269 I320T probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Ythdf1 T C 2: 180,911,993 Y143C probably damaging Het
Zfp213 C T 17: 23,559,629 probably null Het
Zfp219 A T 14: 52,007,113 Y536* probably null Het
Other mutations in Tmed10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0655:Tmed10 UTSW 12 85343517 missense probably damaging 0.96
R0850:Tmed10 UTSW 12 85343505 missense probably benign 0.00
R1780:Tmed10 UTSW 12 85354879 missense probably damaging 1.00
R1845:Tmed10 UTSW 12 85374503 missense possibly damaging 0.73
R7549:Tmed10 UTSW 12 85344262 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTACAATAGCCCTAGAGAAGC -3'
(R):5'- CTTCTTTACGGGTGCAGTGC -3'

Sequencing Primer
(F):5'- GCCCTAGAGAAGCAATTTTATTTCCC -3'
(R):5'- TGCAGTGCAGGCTGTAAG -3'
Posted On2019-10-07