Incidental Mutation 'R7409:Samm50'
ID 574956
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene Name SAMM50 sorting and assembly machinery component
Synonyms 1110030L07Rik
MMRRC Submission 045490-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R7409 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 84076441-84100284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84081231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
AlphaFold Q8BGH2
Predicted Effect probably benign
Transcript: ENSMUST00000023071
AA Change: D53G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: D53G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 C T 4: 129,912,862 (GRCm39) A1329V probably benign Het
Aida A G 1: 183,099,809 (GRCm39) T215A probably benign Het
Alpk2 A G 18: 65,440,023 (GRCm39) S457P probably benign Het
Ap4b1 G A 3: 103,719,474 (GRCm39) V63I probably damaging Het
Apaf1 A G 10: 90,903,108 (GRCm39) V182A probably damaging Het
B4galnt4 G A 7: 140,646,916 (GRCm39) probably null Het
Bltp2 G T 11: 78,159,583 (GRCm39) R544L probably damaging Het
Cacna1a T G 8: 85,260,031 (GRCm39) D331E probably damaging Het
Carmil2 A G 8: 106,419,423 (GRCm39) probably null Het
Cdkn1b A T 6: 134,898,280 (GRCm39) Q133L probably benign Het
Cep192 G C 18: 67,967,874 (GRCm39) S786T possibly damaging Het
Cfap418 T A 4: 10,881,834 (GRCm39) C94S probably benign Het
Cfap97 G A 8: 46,645,733 (GRCm39) R537H probably benign Het
Clpx C G 9: 65,231,529 (GRCm39) A552G possibly damaging Het
Cryl1 G A 14: 57,523,842 (GRCm39) T240I probably damaging Het
Ddx60 C A 8: 62,411,612 (GRCm39) T488K probably benign Het
Dennd4b A G 3: 90,181,259 (GRCm39) H805R probably benign Het
Dnmbp T C 19: 43,878,996 (GRCm39) D25G unknown Het
Dysf A C 6: 84,126,664 (GRCm39) D1293A probably benign Het
Efl1 T C 7: 82,347,121 (GRCm39) L549P probably damaging Het
Eif5 T C 12: 111,506,697 (GRCm39) probably benign Het
Eva1c A G 16: 90,666,544 (GRCm39) K156E probably damaging Het
Fbxw10 T G 11: 62,767,606 (GRCm39) V814G possibly damaging Het
Gfap C T 11: 102,785,358 (GRCm39) R206Q probably benign Het
Gjb6 A T 14: 57,361,610 (GRCm39) L217* probably null Het
Gpatch11 T A 17: 79,146,595 (GRCm39) L80Q probably damaging Het
Gramd1b T C 9: 40,238,727 (GRCm39) Q225R probably damaging Het
Gsdmc2 A G 15: 63,705,195 (GRCm39) S173P possibly damaging Het
Hars1 C G 18: 36,903,166 (GRCm39) R388P probably damaging Het
Ighm C T 12: 113,385,852 (GRCm39) R129H Het
Igsf9 A G 1: 172,322,841 (GRCm39) I602V probably benign Het
Inpp4b T G 8: 82,679,314 (GRCm39) probably null Het
Itch C A 2: 155,041,302 (GRCm39) T450K probably damaging Het
Kcnq1 T C 7: 142,663,152 (GRCm39) F20L unknown Het
Kmt2d G T 15: 98,753,235 (GRCm39) A153E probably damaging Het
Macf1 T A 4: 123,398,263 (GRCm39) N750I probably damaging Het
Marveld2 T A 13: 100,747,984 (GRCm39) H365L probably damaging Het
Med13l T A 5: 118,892,386 (GRCm39) D1936E probably benign Het
Mettl8 A T 2: 70,803,687 (GRCm39) V200E probably damaging Het
Mrgbp T G 2: 180,227,135 (GRCm39) S157A possibly damaging Het
Mrps35 A G 6: 146,957,481 (GRCm39) T169A possibly damaging Het
Mycbp2 A T 14: 103,526,180 (GRCm39) Y551N probably damaging Het
Myo18b T C 5: 113,021,971 (GRCm39) R474G probably benign Het
Nfx1 T A 4: 41,021,830 (GRCm39) S979R possibly damaging Het
Nlrp1a T C 11: 71,013,634 (GRCm39) T539A probably benign Het
Oca2 T A 7: 56,064,145 (GRCm39) D713E probably benign Het
Omt2b A C 9: 78,235,894 (GRCm39) Y73S probably benign Het
Or10aa1 T A 1: 173,870,099 (GRCm39) H194Q probably benign Het
Or13a27 C T 7: 139,925,318 (GRCm39) V195I probably benign Het
Or6c38 A G 10: 128,929,081 (GRCm39) I254T probably damaging Het
Or6c69 A T 10: 129,748,120 (GRCm39) V9D possibly damaging Het
Pde11a G T 2: 75,836,328 (GRCm39) Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Phrf1 C A 7: 140,839,205 (GRCm39) T800K unknown Het
Polr1f T G 12: 33,486,988 (GRCm39) C150W possibly damaging Het
Pramel4 T C 4: 143,795,061 (GRCm39) S486P probably benign Het
Proc T C 18: 32,260,513 (GRCm39) D204G probably benign Het
Rasgrp3 T A 17: 75,823,411 (GRCm39) I494N possibly damaging Het
Satb1 T C 17: 52,116,217 (GRCm39) D22G possibly damaging Het
Scarf2 T C 16: 17,624,918 (GRCm39) S658P probably damaging Het
Sfta2 T A 17: 35,925,410 (GRCm39) I29K unknown Het
Slc15a4 A T 5: 127,681,742 (GRCm39) S292T probably benign Het
Slc37a1 C T 17: 31,559,237 (GRCm39) T439I probably damaging Het
Slc4a9 C A 18: 36,663,858 (GRCm39) P294Q probably damaging Het
Slc52a3 T C 2: 151,846,086 (GRCm39) S16P probably damaging Het
Slc6a15 A G 10: 103,244,163 (GRCm39) I468V probably benign Het
Spag17 T C 3: 99,934,547 (GRCm39) S610P possibly damaging Het
Spag17 A T 3: 99,941,475 (GRCm39) D738V probably benign Het
Ssbp4 T C 8: 71,050,617 (GRCm39) R269G unknown Het
Tbl1xr1 A G 3: 22,257,354 (GRCm39) T406A possibly damaging Het
Tep1 A T 14: 51,104,312 (GRCm39) V194D possibly damaging Het
Thbs4 A T 13: 92,909,767 (GRCm39) C343* probably null Het
Tmed10 A T 12: 85,391,065 (GRCm39) S158T possibly damaging Het
Trbv3 T A 6: 41,025,524 (GRCm39) V38E probably damaging Het
Ttc6 T C 12: 57,743,772 (GRCm39) M1258T probably damaging Het
Ttn T C 2: 76,589,320 (GRCm39) D21281G probably damaging Het
Usp54 T C 14: 20,602,313 (GRCm39) R1346G probably damaging Het
Vmn2r8 C A 5: 108,956,449 (GRCm39) E58* probably null Het
Vps13d C T 4: 144,867,824 (GRCm39) E2009K Het
Vps33b T C 7: 79,935,017 (GRCm39) I320T probably damaging Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Ythdf1 T C 2: 180,553,786 (GRCm39) Y143C probably damaging Het
Zfp213 C T 17: 23,778,603 (GRCm39) probably null Het
Zfp219 A T 14: 52,244,570 (GRCm39) Y536* probably null Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84,084,576 (GRCm39) missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84,086,455 (GRCm39) missense probably benign 0.00
IGL01549:Samm50 APN 15 84,086,982 (GRCm39) missense probably benign
IGL01586:Samm50 APN 15 84,080,039 (GRCm39) missense probably benign 0.03
IGL02494:Samm50 APN 15 84,080,015 (GRCm39) missense probably benign
IGL02607:Samm50 APN 15 84,092,039 (GRCm39) missense probably benign 0.09
IGL03244:Samm50 APN 15 84,098,341 (GRCm39) missense probably benign 0.09
IGL03340:Samm50 APN 15 84,082,864 (GRCm39) critical splice donor site probably null
R0591:Samm50 UTSW 15 84,095,369 (GRCm39) missense probably benign
R0634:Samm50 UTSW 15 84,098,372 (GRCm39) synonymous silent
R1780:Samm50 UTSW 15 84,095,328 (GRCm39) missense probably damaging 0.99
R2192:Samm50 UTSW 15 84,084,625 (GRCm39) critical splice donor site probably null
R2205:Samm50 UTSW 15 84,086,515 (GRCm39) missense probably benign 0.01
R3800:Samm50 UTSW 15 84,076,575 (GRCm39) missense probably damaging 0.99
R4285:Samm50 UTSW 15 84,081,213 (GRCm39) missense probably damaging 1.00
R4333:Samm50 UTSW 15 84,087,031 (GRCm39) missense probably benign 0.02
R4780:Samm50 UTSW 15 84,094,811 (GRCm39) missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84,084,831 (GRCm39) missense probably benign 0.07
R5639:Samm50 UTSW 15 84,098,329 (GRCm39) missense probably benign 0.22
R6258:Samm50 UTSW 15 84,084,513 (GRCm39) missense probably damaging 0.98
R6258:Samm50 UTSW 15 84,084,512 (GRCm39) missense probably damaging 1.00
R6437:Samm50 UTSW 15 84,088,298 (GRCm39) critical splice donor site probably null
R6452:Samm50 UTSW 15 84,088,298 (GRCm39) critical splice donor site probably benign
R6715:Samm50 UTSW 15 84,095,259 (GRCm39) missense probably benign
R6957:Samm50 UTSW 15 84,082,850 (GRCm39) missense probably damaging 1.00
R7459:Samm50 UTSW 15 84,080,057 (GRCm39) critical splice donor site probably null
R7706:Samm50 UTSW 15 84,085,081 (GRCm39) splice site probably null
R7910:Samm50 UTSW 15 84,098,346 (GRCm39) missense possibly damaging 0.49
R8421:Samm50 UTSW 15 84,094,786 (GRCm39) missense probably benign 0.04
R8443:Samm50 UTSW 15 84,094,702 (GRCm39) missense possibly damaging 0.82
R9339:Samm50 UTSW 15 84,095,276 (GRCm39) missense probably benign 0.00
R9457:Samm50 UTSW 15 84,092,042 (GRCm39) missense probably damaging 1.00
X0067:Samm50 UTSW 15 84,087,034 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGTACATACTTGGCAAAAGC -3'
(R):5'- TATGTAAGCTCTGGGAGGCG -3'

Sequencing Primer
(F):5'- TTTCCAGAGGACTTGGATACCAGC -3'
(R):5'- GCTCTGCAGTGAGAGGCTG -3'
Posted On 2019-10-07