Incidental Mutation 'R7409:Alpk2'
ID574968
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7409 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65306952 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 457 (S457P)
Ref Sequence ENSEMBL: ENSMUSP00000114658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably benign
Transcript: ENSMUST00000035548
AA Change: S924P

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: S924P

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141250
AA Change: S457P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: S457P

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,881,834 C94S probably benign Het
2610507B11Rik G T 11: 78,268,757 R544L probably damaging Het
Adgrb2 C T 4: 130,019,069 A1329V probably benign Het
Aida A G 1: 183,318,874 T215A probably benign Het
Ap4b1 G A 3: 103,812,158 V63I probably damaging Het
Apaf1 A G 10: 91,067,246 V182A probably damaging Het
B4galnt4 G A 7: 141,067,003 probably null Het
Cacna1a T G 8: 84,533,402 D331E probably damaging Het
Carmil2 A G 8: 105,692,791 probably null Het
Cdkn1b A T 6: 134,921,317 Q133L probably benign Het
Cep192 G C 18: 67,834,803 S786T possibly damaging Het
Cfap97 G A 8: 46,192,696 R537H probably benign Het
Clpx C G 9: 65,324,247 A552G possibly damaging Het
Cryl1 G A 14: 57,286,385 T240I probably damaging Het
Ddx60 C A 8: 61,958,578 T488K probably benign Het
Dennd4b A G 3: 90,273,952 H805R probably benign Het
Dnmbp T C 19: 43,890,557 D25G unknown Het
Dysf A C 6: 84,149,682 D1293A probably benign Het
Efl1 T C 7: 82,697,913 L549P probably damaging Het
Eif5 T C 12: 111,540,263 probably benign Het
Eva1c A G 16: 90,869,656 K156E probably damaging Het
Fbxw10 T G 11: 62,876,780 V814G possibly damaging Het
Gfap C T 11: 102,894,532 R206Q probably benign Het
Gjb6 A T 14: 57,124,153 L217* probably null Het
Gpatch11 T A 17: 78,839,166 L80Q probably damaging Het
Gramd1b T C 9: 40,327,431 Q225R probably damaging Het
Gsdmc2 A G 15: 63,833,346 S173P possibly damaging Het
Hars C G 18: 36,770,113 R388P probably damaging Het
Ighm C T 12: 113,422,232 R129H Het
Igsf9 A G 1: 172,495,274 I602V probably benign Het
Inpp4b T G 8: 81,952,685 probably null Het
Itch C A 2: 155,199,382 T450K probably damaging Het
Kcnq1 T C 7: 143,109,415 F20L unknown Het
Kmt2d G T 15: 98,855,354 A153E probably damaging Het
Macf1 T A 4: 123,504,470 N750I probably damaging Het
Marveld2 T A 13: 100,611,476 H365L probably damaging Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mettl8 A T 2: 70,973,343 V200E probably damaging Het
Mrgbp T G 2: 180,585,342 S157A possibly damaging Het
Mrps35 A G 6: 147,055,983 T169A possibly damaging Het
Mycbp2 A T 14: 103,288,744 Y551N probably damaging Het
Myo18b T C 5: 112,874,105 R474G probably benign Het
Nfx1 T A 4: 41,021,830 S979R possibly damaging Het
Nlrp1a T C 11: 71,122,808 T539A probably benign Het
Oca2 T A 7: 56,414,397 D713E probably benign Het
Olfr433 T A 1: 174,042,533 H194Q probably benign Het
Olfr60 C T 7: 140,345,405 V195I probably benign Het
Olfr768 A G 10: 129,093,212 I254T probably damaging Het
Olfr816 A T 10: 129,912,251 V9D possibly damaging Het
Omt2b A C 9: 78,328,612 Y73S probably benign Het
Pde11a G T 2: 76,005,984 Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phrf1 C A 7: 141,259,292 T800K unknown Het
Pramel4 T C 4: 144,068,491 S486P probably benign Het
Proc T C 18: 32,127,460 D204G probably benign Het
Rasgrp3 T A 17: 75,516,416 I494N possibly damaging Het
Samm50 A G 15: 84,197,030 D53G probably benign Het
Satb1 T C 17: 51,809,189 D22G possibly damaging Het
Scarf2 T C 16: 17,807,054 S658P probably damaging Het
Sfta2 T A 17: 35,614,518 I29K unknown Het
Slc15a4 A T 5: 127,604,678 S292T probably benign Het
Slc37a1 C T 17: 31,340,263 T439I probably damaging Het
Slc4a9 C A 18: 36,530,805 P294Q probably damaging Het
Slc52a3 T C 2: 152,004,166 S16P probably damaging Het
Slc6a15 A G 10: 103,408,302 I468V probably benign Het
Spag17 T C 3: 100,027,231 S610P possibly damaging Het
Spag17 A T 3: 100,034,159 D738V probably benign Het
Ssbp4 T C 8: 70,597,967 R269G unknown Het
Tbl1xr1 A G 3: 22,203,190 T406A possibly damaging Het
Tep1 A T 14: 50,866,855 V194D possibly damaging Het
Thbs4 A T 13: 92,773,259 C343* probably null Het
Tmed10 A T 12: 85,344,291 S158T possibly damaging Het
Trbv3 T A 6: 41,048,590 V38E probably damaging Het
Ttc6 T C 12: 57,696,986 M1258T probably damaging Het
Ttn T C 2: 76,758,976 D21281G probably damaging Het
Twistnb T G 12: 33,436,989 C150W possibly damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn2r8 C A 5: 108,808,583 E58* probably null Het
Vps13d C T 4: 145,141,254 E2009K Het
Vps33b T C 7: 80,285,269 I320T probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Ythdf1 T C 2: 180,911,993 Y143C probably damaging Het
Zfp213 C T 17: 23,559,629 probably null Het
Zfp219 A T 14: 52,007,113 Y536* probably null Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCGGCATTAGTTGATATGCC -3'
(R):5'- ACAAGGTTCTGAGCCTCCAC -3'

Sequencing Primer
(F):5'- GGCATTAGTTGATATGCCCTCCATC -3'
(R):5'- CCAGGATGGCAAGTCAGC -3'
Posted On2019-10-07