Incidental Mutation 'R7409:Dnmbp'
ID574970
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Namedynamin binding protein
Synonyms2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7409 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location43846821-43940191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43890557 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 25 (D25G)
Ref Sequence ENSEMBL: ENSMUSP00000148546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396]
Predicted Effect probably benign
Transcript: ENSMUST00000026209
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212032
Predicted Effect unknown
Transcript: ENSMUST00000212048
AA Change: D25G
Predicted Effect probably benign
Transcript: ENSMUST00000212396
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,881,834 C94S probably benign Het
2610507B11Rik G T 11: 78,268,757 R544L probably damaging Het
Adgrb2 C T 4: 130,019,069 A1329V probably benign Het
Aida A G 1: 183,318,874 T215A probably benign Het
Alpk2 A G 18: 65,306,952 S457P probably benign Het
Ap4b1 G A 3: 103,812,158 V63I probably damaging Het
Apaf1 A G 10: 91,067,246 V182A probably damaging Het
B4galnt4 G A 7: 141,067,003 probably null Het
Cacna1a T G 8: 84,533,402 D331E probably damaging Het
Carmil2 A G 8: 105,692,791 probably null Het
Cdkn1b A T 6: 134,921,317 Q133L probably benign Het
Cep192 G C 18: 67,834,803 S786T possibly damaging Het
Cfap97 G A 8: 46,192,696 R537H probably benign Het
Clpx C G 9: 65,324,247 A552G possibly damaging Het
Cryl1 G A 14: 57,286,385 T240I probably damaging Het
Ddx60 C A 8: 61,958,578 T488K probably benign Het
Dennd4b A G 3: 90,273,952 H805R probably benign Het
Dysf A C 6: 84,149,682 D1293A probably benign Het
Efl1 T C 7: 82,697,913 L549P probably damaging Het
Eif5 T C 12: 111,540,263 probably benign Het
Eva1c A G 16: 90,869,656 K156E probably damaging Het
Fbxw10 T G 11: 62,876,780 V814G possibly damaging Het
Gfap C T 11: 102,894,532 R206Q probably benign Het
Gjb6 A T 14: 57,124,153 L217* probably null Het
Gpatch11 T A 17: 78,839,166 L80Q probably damaging Het
Gramd1b T C 9: 40,327,431 Q225R probably damaging Het
Gsdmc2 A G 15: 63,833,346 S173P possibly damaging Het
Hars C G 18: 36,770,113 R388P probably damaging Het
Ighm C T 12: 113,422,232 R129H Het
Igsf9 A G 1: 172,495,274 I602V probably benign Het
Inpp4b T G 8: 81,952,685 probably null Het
Itch C A 2: 155,199,382 T450K probably damaging Het
Kcnq1 T C 7: 143,109,415 F20L unknown Het
Kmt2d G T 15: 98,855,354 A153E probably damaging Het
Macf1 T A 4: 123,504,470 N750I probably damaging Het
Marveld2 T A 13: 100,611,476 H365L probably damaging Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mettl8 A T 2: 70,973,343 V200E probably damaging Het
Mrgbp T G 2: 180,585,342 S157A possibly damaging Het
Mrps35 A G 6: 147,055,983 T169A possibly damaging Het
Mycbp2 A T 14: 103,288,744 Y551N probably damaging Het
Myo18b T C 5: 112,874,105 R474G probably benign Het
Nfx1 T A 4: 41,021,830 S979R possibly damaging Het
Nlrp1a T C 11: 71,122,808 T539A probably benign Het
Oca2 T A 7: 56,414,397 D713E probably benign Het
Olfr433 T A 1: 174,042,533 H194Q probably benign Het
Olfr60 C T 7: 140,345,405 V195I probably benign Het
Olfr768 A G 10: 129,093,212 I254T probably damaging Het
Olfr816 A T 10: 129,912,251 V9D possibly damaging Het
Omt2b A C 9: 78,328,612 Y73S probably benign Het
Pde11a G T 2: 76,005,984 Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phrf1 C A 7: 141,259,292 T800K unknown Het
Pramel4 T C 4: 144,068,491 S486P probably benign Het
Proc T C 18: 32,127,460 D204G probably benign Het
Rasgrp3 T A 17: 75,516,416 I494N possibly damaging Het
Samm50 A G 15: 84,197,030 D53G probably benign Het
Satb1 T C 17: 51,809,189 D22G possibly damaging Het
Scarf2 T C 16: 17,807,054 S658P probably damaging Het
Sfta2 T A 17: 35,614,518 I29K unknown Het
Slc15a4 A T 5: 127,604,678 S292T probably benign Het
Slc37a1 C T 17: 31,340,263 T439I probably damaging Het
Slc4a9 C A 18: 36,530,805 P294Q probably damaging Het
Slc52a3 T C 2: 152,004,166 S16P probably damaging Het
Slc6a15 A G 10: 103,408,302 I468V probably benign Het
Spag17 T C 3: 100,027,231 S610P possibly damaging Het
Spag17 A T 3: 100,034,159 D738V probably benign Het
Ssbp4 T C 8: 70,597,967 R269G unknown Het
Tbl1xr1 A G 3: 22,203,190 T406A possibly damaging Het
Tep1 A T 14: 50,866,855 V194D possibly damaging Het
Thbs4 A T 13: 92,773,259 C343* probably null Het
Tmed10 A T 12: 85,344,291 S158T possibly damaging Het
Trbv3 T A 6: 41,048,590 V38E probably damaging Het
Ttc6 T C 12: 57,696,986 M1258T probably damaging Het
Ttn T C 2: 76,758,976 D21281G probably damaging Het
Twistnb T G 12: 33,436,989 C150W possibly damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn2r8 C A 5: 108,808,583 E58* probably null Het
Vps13d C T 4: 145,141,254 E2009K Het
Vps33b T C 7: 80,285,269 I320T probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Ythdf1 T C 2: 180,911,993 Y143C probably damaging Het
Zfp213 C T 17: 23,559,629 probably null Het
Zfp219 A T 14: 52,007,113 Y536* probably null Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TAAGGCTTCTTTTCCGGAGG -3'
(R):5'- TGACCAGCTCAGGGAAACAC -3'

Sequencing Primer
(F):5'- GGAGGCTCCTGCAGTCTTCATAC -3'
(R):5'- GCTCAGGGAAACACCAACAATACTG -3'
Posted On2019-10-07