Incidental Mutation 'R7409:Dnmbp'
ID 574970
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7409 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43890557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 25 (D25G)
Ref Sequence ENSEMBL: ENSMUSP00000148546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026209
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212032
Predicted Effect unknown
Transcript: ENSMUST00000212048
AA Change: D25G
Predicted Effect probably benign
Transcript: ENSMUST00000212396
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,881,834 C94S probably benign Het
2610507B11Rik G T 11: 78,268,757 R544L probably damaging Het
Adgrb2 C T 4: 130,019,069 A1329V probably benign Het
Aida A G 1: 183,318,874 T215A probably benign Het
Alpk2 A G 18: 65,306,952 S457P probably benign Het
Ap4b1 G A 3: 103,812,158 V63I probably damaging Het
Apaf1 A G 10: 91,067,246 V182A probably damaging Het
B4galnt4 G A 7: 141,067,003 probably null Het
Cacna1a T G 8: 84,533,402 D331E probably damaging Het
Carmil2 A G 8: 105,692,791 probably null Het
Cdkn1b A T 6: 134,921,317 Q133L probably benign Het
Cep192 G C 18: 67,834,803 S786T possibly damaging Het
Cfap97 G A 8: 46,192,696 R537H probably benign Het
Clpx C G 9: 65,324,247 A552G possibly damaging Het
Cryl1 G A 14: 57,286,385 T240I probably damaging Het
Ddx60 C A 8: 61,958,578 T488K probably benign Het
Dennd4b A G 3: 90,273,952 H805R probably benign Het
Dysf A C 6: 84,149,682 D1293A probably benign Het
Efl1 T C 7: 82,697,913 L549P probably damaging Het
Eif5 T C 12: 111,540,263 probably benign Het
Eva1c A G 16: 90,869,656 K156E probably damaging Het
Fbxw10 T G 11: 62,876,780 V814G possibly damaging Het
Gfap C T 11: 102,894,532 R206Q probably benign Het
Gjb6 A T 14: 57,124,153 L217* probably null Het
Gpatch11 T A 17: 78,839,166 L80Q probably damaging Het
Gramd1b T C 9: 40,327,431 Q225R probably damaging Het
Gsdmc2 A G 15: 63,833,346 S173P possibly damaging Het
Hars C G 18: 36,770,113 R388P probably damaging Het
Ighm C T 12: 113,422,232 R129H Het
Igsf9 A G 1: 172,495,274 I602V probably benign Het
Inpp4b T G 8: 81,952,685 probably null Het
Itch C A 2: 155,199,382 T450K probably damaging Het
Kcnq1 T C 7: 143,109,415 F20L unknown Het
Kmt2d G T 15: 98,855,354 A153E probably damaging Het
Macf1 T A 4: 123,504,470 N750I probably damaging Het
Marveld2 T A 13: 100,611,476 H365L probably damaging Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mettl8 A T 2: 70,973,343 V200E probably damaging Het
Mrgbp T G 2: 180,585,342 S157A possibly damaging Het
Mrps35 A G 6: 147,055,983 T169A possibly damaging Het
Mycbp2 A T 14: 103,288,744 Y551N probably damaging Het
Myo18b T C 5: 112,874,105 R474G probably benign Het
Nfx1 T A 4: 41,021,830 S979R possibly damaging Het
Nlrp1a T C 11: 71,122,808 T539A probably benign Het
Oca2 T A 7: 56,414,397 D713E probably benign Het
Olfr433 T A 1: 174,042,533 H194Q probably benign Het
Olfr60 C T 7: 140,345,405 V195I probably benign Het
Olfr768 A G 10: 129,093,212 I254T probably damaging Het
Olfr816 A T 10: 129,912,251 V9D possibly damaging Het
Omt2b A C 9: 78,328,612 Y73S probably benign Het
Pde11a G T 2: 76,005,984 Q20K Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phrf1 C A 7: 141,259,292 T800K unknown Het
Pramel4 T C 4: 144,068,491 S486P probably benign Het
Proc T C 18: 32,127,460 D204G probably benign Het
Rasgrp3 T A 17: 75,516,416 I494N possibly damaging Het
Samm50 A G 15: 84,197,030 D53G probably benign Het
Satb1 T C 17: 51,809,189 D22G possibly damaging Het
Scarf2 T C 16: 17,807,054 S658P probably damaging Het
Sfta2 T A 17: 35,614,518 I29K unknown Het
Slc15a4 A T 5: 127,604,678 S292T probably benign Het
Slc37a1 C T 17: 31,340,263 T439I probably damaging Het
Slc4a9 C A 18: 36,530,805 P294Q probably damaging Het
Slc52a3 T C 2: 152,004,166 S16P probably damaging Het
Slc6a15 A G 10: 103,408,302 I468V probably benign Het
Spag17 T C 3: 100,027,231 S610P possibly damaging Het
Spag17 A T 3: 100,034,159 D738V probably benign Het
Ssbp4 T C 8: 70,597,967 R269G unknown Het
Tbl1xr1 A G 3: 22,203,190 T406A possibly damaging Het
Tep1 A T 14: 50,866,855 V194D possibly damaging Het
Thbs4 A T 13: 92,773,259 C343* probably null Het
Tmed10 A T 12: 85,344,291 S158T possibly damaging Het
Trbv3 T A 6: 41,048,590 V38E probably damaging Het
Ttc6 T C 12: 57,696,986 M1258T probably damaging Het
Ttn T C 2: 76,758,976 D21281G probably damaging Het
Twistnb T G 12: 33,436,989 C150W possibly damaging Het
Usp54 T C 14: 20,552,245 R1346G probably damaging Het
Vmn2r8 C A 5: 108,808,583 E58* probably null Het
Vps13d C T 4: 145,141,254 E2009K Het
Vps33b T C 7: 80,285,269 I320T probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Ythdf1 T C 2: 180,911,993 Y143C probably damaging Het
Zfp213 C T 17: 23,559,629 probably null Het
Zfp219 A T 14: 52,007,113 Y536* probably null Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9628:Dnmbp UTSW 19 43870207 missense probably damaging 0.99
R9635:Dnmbp UTSW 19 43867535 missense probably benign 0.39
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TAAGGCTTCTTTTCCGGAGG -3'
(R):5'- TGACCAGCTCAGGGAAACAC -3'

Sequencing Primer
(F):5'- GGAGGCTCCTGCAGTCTTCATAC -3'
(R):5'- GCTCAGGGAAACACCAACAATACTG -3'
Posted On 2019-10-07