Incidental Mutation 'R7410:Fam227b'
ID574980
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Namefamily with sequence similarity 227, member B
Synonyms4930525F21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7410 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125983483-126152004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126119063 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 215 (D215E)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably damaging
Transcript: ENSMUST00000110446
AA Change: D215E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: D215E

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110448
AA Change: D215E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: D215E

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably damaging
Transcript: ENSMUST00000178118
AA Change: D215E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: D215E

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal coat appearance, abnormal kidney morphology, spleen hypoplasia, decreased vesicles clustering in GABAergic synapses, decreased miniature inhibitory postsynaptic currents, and increased susceptibility to drug-induced seizures.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,244 S3P unknown Het
Adgrv1 A T 13: 81,563,619 D1079E probably benign Het
Agbl5 A T 5: 30,890,688 Y102F possibly damaging Het
Ankfy1 T C 11: 72,761,504 L1094S probably damaging Het
Ankrd42 A T 7: 92,610,554 V337E possibly damaging Het
Axl A G 7: 25,758,783 L849P probably benign Het
Bmpr2 T C 1: 59,868,493 I915T probably benign Het
Cables1 T A 18: 11,941,225 F494L probably benign Het
Cacna1e A C 1: 154,472,234 V927G probably benign Het
Cavin1 A T 11: 100,958,844 V320E probably damaging Het
Cemip T G 7: 83,952,834 S916R probably damaging Het
Cep57 G A 9: 13,818,684 probably benign Het
Ces1d T C 8: 93,192,805 N120D probably damaging Het
Cfap44 A T 16: 44,468,413 S1509C probably damaging Het
Chga A G 12: 102,562,607 D281G probably benign Het
Clstn2 A G 9: 97,541,867 F282L probably benign Het
Cnot1 A T 8: 95,733,159 V1855E possibly damaging Het
Cnr1 T A 4: 33,944,119 V169D probably damaging Het
Cpd T A 11: 76,782,308 H1337L probably damaging Het
Crabp2 T A 3: 87,952,278 D78E probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp2ab1 G A 16: 20,316,725 A9V probably benign Het
Cyp3a41b T C 5: 145,578,157 D86G probably damaging Het
Dner T A 1: 84,585,611 D96V probably damaging Het
Duox1 C A 2: 122,346,393 T1465N probably damaging Het
Ehd3 T A 17: 73,805,433 V64E probably benign Het
Ehmt1 A G 2: 24,848,068 V508A probably benign Het
Ephb3 G A 16: 21,221,408 V761I possibly damaging Het
Fam161b T C 12: 84,357,801 Q35R probably benign Het
Fam186a T A 15: 99,946,945 K473* probably null Het
Fkbp15 C A 4: 62,340,299 D144Y probably damaging Het
Galt T C 4: 41,757,707 I259T possibly damaging Het
Gbp11 G A 5: 105,343,908 P8S probably damaging Het
Gfap A T 11: 102,893,137 M339K probably damaging Het
Gm14443 C T 2: 175,169,276 R459Q possibly damaging Het
Grip1 A G 10: 120,020,020 N632S probably benign Het
Hcar1 T G 5: 123,879,098 I177L possibly damaging Het
Hist1h4n G A 13: 21,832,041 R40W probably damaging Het
Ighv1-37 A G 12: 114,896,479 V37A probably damaging Het
Ilf3 T A 9: 21,399,804 F657L unknown Het
Ints2 T G 11: 86,233,226 T579P probably benign Het
Iqgap1 G T 7: 80,723,030 Y1520* probably null Het
Kdm4a T C 4: 118,143,918 H884R possibly damaging Het
Krtap19-1 A T 16: 88,869,244 Y52N unknown Het
Lama5 A T 2: 180,202,390 probably null Het
Lrrc72 T C 12: 36,222,804 N89D probably damaging Het
Med13l A G 5: 118,560,832 D16G possibly damaging Het
Mefv A G 16: 3,715,681 L242P probably damaging Het
Mob3c T C 4: 115,831,587 Y106H probably damaging Het
Nlrp1a A G 11: 71,123,857 I189T probably damaging Het
Nudt7 T C 8: 114,133,819 probably benign Het
Olfr1303 T A 2: 111,813,926 I267L probably benign Het
Olfr62 T C 4: 118,666,432 L305P probably benign Het
Pappa A G 4: 65,335,719 T1537A probably damaging Het
Pik3r4 T A 9: 105,650,591 V381E probably damaging Het
Pkd1 T A 17: 24,575,881 Y2181N probably damaging Het
Pmel G T 10: 128,716,484 V396F probably benign Het
Prdm9 A G 17: 15,544,997 I507T possibly damaging Het
Psme4 C T 11: 30,815,279 Q549* probably null Het
Ptprg T A 14: 11,962,657 W152R probably damaging Het
Ptprm A C 17: 66,693,566 V1141G probably damaging Het
Rapgef5 G A 12: 117,721,328 V505M probably damaging Het
Rnf213 T A 11: 119,435,051 M1558K Het
Slc35a1 A G 4: 34,675,034 V168A probably benign Het
Srebf1 T C 11: 60,205,867 T347A probably benign Het
Stard9 T A 2: 120,701,497 V2745D probably benign Het
Taar7e A T 10: 24,038,526 T305S probably benign Het
Tie1 T C 4: 118,479,877 S551G probably benign Het
Tmc5 T A 7: 118,623,597 Y173* probably null Het
Tns2 T A 15: 102,110,526 V384D probably damaging Het
Tubgcp4 T A 2: 121,184,409 Y267N probably damaging Het
Vmn1r53 A G 6: 90,223,718 V208A probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 T C 14: 32,974,234 D2784G Het
Zfp712 A C 13: 67,041,336 S376A probably benign Het
Znrf3 C T 11: 5,288,955 C232Y unknown Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R2884:Fam227b UTSW 2 126100926 missense probably benign 0.01
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3937:Fam227b UTSW 2 126127060 missense probably benign 0.01
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126146268 unclassified probably benign
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4457:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6660:Fam227b UTSW 2 126144307 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTATTCAGGATAATGGTCATGGTG -3'
(R):5'- TGCTGAAACAAATGGCCCC -3'

Sequencing Primer
(F):5'- CAGGATAATGGTCATGGTGGTAAAAC -3'
(R):5'- TGGCCCCTCAAGTTAAATAGCTG -3'
Posted On2019-10-07