Incidental Mutation 'R7410:Iqgap1'
ID575001
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7410 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 80723030 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1520 (Y1520*)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably null
Transcript: ENSMUST00000167377
AA Change: Y1520*
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: Y1520*

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205606
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,244 S3P unknown Het
Adgrv1 A T 13: 81,563,619 D1079E probably benign Het
Agbl5 A T 5: 30,890,688 Y102F possibly damaging Het
Ankfy1 T C 11: 72,761,504 L1094S probably damaging Het
Ankrd42 A T 7: 92,610,554 V337E possibly damaging Het
Axl A G 7: 25,758,783 L849P probably benign Het
Bmpr2 T C 1: 59,868,493 I915T probably benign Het
Cables1 T A 18: 11,941,225 F494L probably benign Het
Cacna1e A C 1: 154,472,234 V927G probably benign Het
Cavin1 A T 11: 100,958,844 V320E probably damaging Het
Cemip T G 7: 83,952,834 S916R probably damaging Het
Cep57 G A 9: 13,818,684 probably benign Het
Ces1d T C 8: 93,192,805 N120D probably damaging Het
Cfap44 A T 16: 44,468,413 S1509C probably damaging Het
Chga A G 12: 102,562,607 D281G probably benign Het
Clstn2 A G 9: 97,541,867 F282L probably benign Het
Cnot1 A T 8: 95,733,159 V1855E possibly damaging Het
Cnr1 T A 4: 33,944,119 V169D probably damaging Het
Cpd T A 11: 76,782,308 H1337L probably damaging Het
Crabp2 T A 3: 87,952,278 D78E probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp2ab1 G A 16: 20,316,725 A9V probably benign Het
Cyp3a41b T C 5: 145,578,157 D86G probably damaging Het
Dner T A 1: 84,585,611 D96V probably damaging Het
Duox1 C A 2: 122,346,393 T1465N probably damaging Het
Ehd3 T A 17: 73,805,433 V64E probably benign Het
Ehmt1 A G 2: 24,848,068 V508A probably benign Het
Ephb3 G A 16: 21,221,408 V761I possibly damaging Het
Fam161b T C 12: 84,357,801 Q35R probably benign Het
Fam186a T A 15: 99,946,945 K473* probably null Het
Fam227b A T 2: 126,119,063 D215E probably damaging Het
Fkbp15 C A 4: 62,340,299 D144Y probably damaging Het
Galt T C 4: 41,757,707 I259T possibly damaging Het
Gbp11 G A 5: 105,343,908 P8S probably damaging Het
Gfap A T 11: 102,893,137 M339K probably damaging Het
Gm14443 C T 2: 175,169,276 R459Q possibly damaging Het
Grip1 A G 10: 120,020,020 N632S probably benign Het
Hcar1 T G 5: 123,879,098 I177L possibly damaging Het
Hist1h4n G A 13: 21,832,041 R40W probably damaging Het
Ighv1-37 A G 12: 114,896,479 V37A probably damaging Het
Ilf3 T A 9: 21,399,804 F657L unknown Het
Ints2 T G 11: 86,233,226 T579P probably benign Het
Kdm4a T C 4: 118,143,918 H884R possibly damaging Het
Krtap19-1 A T 16: 88,869,244 Y52N unknown Het
Lama5 A T 2: 180,202,390 probably null Het
Lrrc72 T C 12: 36,222,804 N89D probably damaging Het
Med13l A G 5: 118,560,832 D16G possibly damaging Het
Mefv A G 16: 3,715,681 L242P probably damaging Het
Mob3c T C 4: 115,831,587 Y106H probably damaging Het
Nlrp1a A G 11: 71,123,857 I189T probably damaging Het
Nudt7 T C 8: 114,133,819 probably benign Het
Olfr1303 T A 2: 111,813,926 I267L probably benign Het
Olfr62 T C 4: 118,666,432 L305P probably benign Het
Pappa A G 4: 65,335,719 T1537A probably damaging Het
Pik3r4 T A 9: 105,650,591 V381E probably damaging Het
Pkd1 T A 17: 24,575,881 Y2181N probably damaging Het
Pmel G T 10: 128,716,484 V396F probably benign Het
Prdm9 A G 17: 15,544,997 I507T possibly damaging Het
Psme4 C T 11: 30,815,279 Q549* probably null Het
Ptprg T A 14: 11,962,657 W152R probably damaging Het
Ptprm A C 17: 66,693,566 V1141G probably damaging Het
Rapgef5 G A 12: 117,721,328 V505M probably damaging Het
Rnf213 T A 11: 119,435,051 M1558K Het
Slc35a1 A G 4: 34,675,034 V168A probably benign Het
Srebf1 T C 11: 60,205,867 T347A probably benign Het
Stard9 T A 2: 120,701,497 V2745D probably benign Het
Taar7e A T 10: 24,038,526 T305S probably benign Het
Tie1 T C 4: 118,479,877 S551G probably benign Het
Tmc5 T A 7: 118,623,597 Y173* probably null Het
Tns2 T A 15: 102,110,526 V384D probably damaging Het
Tubgcp4 T A 2: 121,184,409 Y267N probably damaging Het
Vmn1r53 A G 6: 90,223,718 V208A probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 T C 14: 32,974,234 D2784G Het
Zfp712 A C 13: 67,041,336 S376A probably benign Het
Znrf3 C T 11: 5,288,955 C232Y unknown Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80743888 missense probably benign 0.04
R8270:Iqgap1 UTSW 7 80730127 missense probably damaging 1.00
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACATTAGCAACAGGACATTTG -3'
(R):5'- AGTGTTCATGAACGGCGATG -3'

Sequencing Primer
(F):5'- TGGAACTCACTTTGTACACCAGG -3'
(R):5'- GCGATGGTTCAAGAGGCAC -3'
Posted On2019-10-07