Incidental Mutation 'R7410:Ankfy1'
ID 575019
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Name ankyrin repeat and FYVE domain containing 1
Synonyms Ankhzn
MMRRC Submission
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 72690006-72772146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72761504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 1094 (L1094S)
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
AlphaFold Q810B6
Predicted Effect probably benign
Transcript: ENSMUST00000127610
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155998
AA Change: L1094S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: L1094S

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,244 S3P unknown Het
Adgrv1 A T 13: 81,563,619 D1079E probably benign Het
Agbl5 A T 5: 30,890,688 Y102F possibly damaging Het
Ankrd42 A T 7: 92,610,554 V337E possibly damaging Het
Axl A G 7: 25,758,783 L849P probably benign Het
Bmpr2 T C 1: 59,868,493 I915T probably benign Het
Cables1 T A 18: 11,941,225 F494L probably benign Het
Cacna1e A C 1: 154,472,234 V927G probably benign Het
Cavin1 A T 11: 100,958,844 V320E probably damaging Het
Cemip T G 7: 83,952,834 S916R probably damaging Het
Cep57 G A 9: 13,818,684 probably benign Het
Ces1d T C 8: 93,192,805 N120D probably damaging Het
Cfap44 A T 16: 44,468,413 S1509C probably damaging Het
Chga A G 12: 102,562,607 D281G probably benign Het
Clstn2 A G 9: 97,541,867 F282L probably benign Het
Cnot1 A T 8: 95,733,159 V1855E possibly damaging Het
Cnr1 T A 4: 33,944,119 V169D probably damaging Het
Cpd T A 11: 76,782,308 H1337L probably damaging Het
Crabp2 T A 3: 87,952,278 D78E probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp2ab1 G A 16: 20,316,725 A9V probably benign Het
Cyp3a41b T C 5: 145,578,157 D86G probably damaging Het
Dner T A 1: 84,585,611 D96V probably damaging Het
Duox1 C A 2: 122,346,393 T1465N probably damaging Het
Ehd3 T A 17: 73,805,433 V64E probably benign Het
Ehmt1 A G 2: 24,848,068 V508A probably benign Het
Ephb3 G A 16: 21,221,408 V761I possibly damaging Het
Fam161b T C 12: 84,357,801 Q35R probably benign Het
Fam186a T A 15: 99,946,945 K473* probably null Het
Fam227b A T 2: 126,119,063 D215E probably damaging Het
Fkbp15 C A 4: 62,340,299 D144Y probably damaging Het
Galt T C 4: 41,757,707 I259T possibly damaging Het
Gbp11 G A 5: 105,343,908 P8S probably damaging Het
Gfap A T 11: 102,893,137 M339K probably damaging Het
Gm14443 C T 2: 175,169,276 R459Q possibly damaging Het
Grip1 A G 10: 120,020,020 N632S probably benign Het
Hcar1 T G 5: 123,879,098 I177L possibly damaging Het
Hist1h4n G A 13: 21,832,041 R40W probably damaging Het
Ighv1-37 A G 12: 114,896,479 V37A probably damaging Het
Ilf3 T A 9: 21,399,804 F657L unknown Het
Ints2 T G 11: 86,233,226 T579P probably benign Het
Iqgap1 G T 7: 80,723,030 Y1520* probably null Het
Kdm4a T C 4: 118,143,918 H884R possibly damaging Het
Krtap19-1 A T 16: 88,869,244 Y52N unknown Het
Lama5 A T 2: 180,202,390 probably null Het
Lrrc72 T C 12: 36,222,804 N89D probably damaging Het
Med13l A G 5: 118,560,832 D16G possibly damaging Het
Mefv A G 16: 3,715,681 L242P probably damaging Het
Mob3c T C 4: 115,831,587 Y106H probably damaging Het
Nlrp1a A G 11: 71,123,857 I189T probably damaging Het
Nudt7 T C 8: 114,133,819 probably benign Het
Olfr1303 T A 2: 111,813,926 I267L probably benign Het
Olfr62 T C 4: 118,666,432 L305P probably benign Het
Pappa A G 4: 65,335,719 T1537A probably damaging Het
Pik3r4 T A 9: 105,650,591 V381E probably damaging Het
Pkd1 T A 17: 24,575,881 Y2181N probably damaging Het
Pmel G T 10: 128,716,484 V396F probably benign Het
Prdm9 A G 17: 15,544,997 I507T possibly damaging Het
Psme4 C T 11: 30,815,279 Q549* probably null Het
Ptprg T A 14: 11,962,657 W152R probably damaging Het
Ptprm A C 17: 66,693,566 V1141G probably damaging Het
Rapgef5 G A 12: 117,721,328 V505M probably damaging Het
Rnf213 T A 11: 119,435,051 M1558K Het
Slc35a1 A G 4: 34,675,034 V168A probably benign Het
Srebf1 T C 11: 60,205,867 T347A probably benign Het
Stard9 T A 2: 120,701,497 V2745D probably benign Het
Taar7e A T 10: 24,038,526 T305S probably benign Het
Tie1 T C 4: 118,479,877 S551G probably benign Het
Tmc5 T A 7: 118,623,597 Y173* probably null Het
Tns2 T A 15: 102,110,526 V384D probably damaging Het
Tubgcp4 T A 2: 121,184,409 Y267N probably damaging Het
Vmn1r53 A G 6: 90,223,718 V208A probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 T C 14: 32,974,234 D2784G Het
Zfp712 A C 13: 67,041,336 S376A probably benign Het
Znrf3 C T 11: 5,288,955 C232Y unknown Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754 splice site probably benign
Betruenken UTSW 11 72753608 missense possibly damaging 0.78
Inebriated UTSW 11 72752105 missense probably benign
Smashed UTSW 11 72712204 missense probably damaging 1.00
woozy UTSW 11 72754459 missense probably benign 0.33
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1565:Ankfy1 UTSW 11 72757318 missense probably damaging 1.00
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R2421:Ankfy1 UTSW 11 72755896 splice site probably benign
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5471:Ankfy1 UTSW 11 72728791 missense probably benign 0.01
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5770:Ankfy1 UTSW 11 72760256 missense probably damaging 1.00
R5896:Ankfy1 UTSW 11 72759985 missense probably damaging 0.98
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R7006:Ankfy1 UTSW 11 72740464 missense probably benign 0.01
R7329:Ankfy1 UTSW 11 72712208 missense probably damaging 0.96
R7393:Ankfy1 UTSW 11 72738308 missense possibly damaging 0.70
R7488:Ankfy1 UTSW 11 72759943 missense probably benign 0.05
R7731:Ankfy1 UTSW 11 72712281 missense probably benign 0.00
R7810:Ankfy1 UTSW 11 72754455 nonsense probably null
R8236:Ankfy1 UTSW 11 72754355 missense possibly damaging 0.90
R8709:Ankfy1 UTSW 11 72755706 missense possibly damaging 0.91
R8717:Ankfy1 UTSW 11 72730474 missense probably benign 0.01
R8839:Ankfy1 UTSW 11 72730566 missense probably benign 0.39
R8862:Ankfy1 UTSW 11 72753643 missense probably benign 0.18
R8954:Ankfy1 UTSW 11 72750491 missense possibly damaging 0.91
R9548:Ankfy1 UTSW 11 72750179 critical splice donor site probably null
R9762:Ankfy1 UTSW 11 72730575 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCCTGCCAGTATTCTGC -3'
(R):5'- CAGGAGGCATAGTCAGTATGAC -3'

Sequencing Primer
(F):5'- CATCCTTTGGCTGCTGGGAAAC -3'
(R):5'- TCAGTATGACTAGCTGAGGTTTG -3'
Posted On 2019-10-07