Incidental Mutation 'R7410:Lrrc72'
ID575025
Institutional Source Beutler Lab
Gene Symbol Lrrc72
Ensembl Gene ENSMUSG00000020545
Gene Nameleucine rich repeat containing 72
Synonyms1700108M19Rik, 4933421E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7410 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location36208345-36253398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36222804 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 89 (N89D)
Ref Sequence ENSEMBL: ENSMUSP00000152732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020853] [ENSMUST00000122115] [ENSMUST00000221155]
Predicted Effect probably benign
Transcript: ENSMUST00000020853
Predicted Effect probably benign
Transcript: ENSMUST00000122115
SMART Domains Protein: ENSMUSP00000113517
Gene: ENSMUSG00000020545

DomainStartEndE-ValueType
Pfam:LRR_9 1 69 6.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221155
AA Change: N89D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,244 S3P unknown Het
Adgrv1 A T 13: 81,563,619 D1079E probably benign Het
Agbl5 A T 5: 30,890,688 Y102F possibly damaging Het
Ankfy1 T C 11: 72,761,504 L1094S probably damaging Het
Ankrd42 A T 7: 92,610,554 V337E possibly damaging Het
Axl A G 7: 25,758,783 L849P probably benign Het
Bmpr2 T C 1: 59,868,493 I915T probably benign Het
Cables1 T A 18: 11,941,225 F494L probably benign Het
Cacna1e A C 1: 154,472,234 V927G probably benign Het
Cavin1 A T 11: 100,958,844 V320E probably damaging Het
Cemip T G 7: 83,952,834 S916R probably damaging Het
Cep57 G A 9: 13,818,684 probably benign Het
Ces1d T C 8: 93,192,805 N120D probably damaging Het
Cfap44 A T 16: 44,468,413 S1509C probably damaging Het
Chga A G 12: 102,562,607 D281G probably benign Het
Clstn2 A G 9: 97,541,867 F282L probably benign Het
Cnot1 A T 8: 95,733,159 V1855E possibly damaging Het
Cnr1 T A 4: 33,944,119 V169D probably damaging Het
Cpd T A 11: 76,782,308 H1337L probably damaging Het
Crabp2 T A 3: 87,952,278 D78E probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp2ab1 G A 16: 20,316,725 A9V probably benign Het
Cyp3a41b T C 5: 145,578,157 D86G probably damaging Het
Dner T A 1: 84,585,611 D96V probably damaging Het
Duox1 C A 2: 122,346,393 T1465N probably damaging Het
Ehd3 T A 17: 73,805,433 V64E probably benign Het
Ehmt1 A G 2: 24,848,068 V508A probably benign Het
Ephb3 G A 16: 21,221,408 V761I possibly damaging Het
Fam161b T C 12: 84,357,801 Q35R probably benign Het
Fam186a T A 15: 99,946,945 K473* probably null Het
Fam227b A T 2: 126,119,063 D215E probably damaging Het
Fkbp15 C A 4: 62,340,299 D144Y probably damaging Het
Galt T C 4: 41,757,707 I259T possibly damaging Het
Gbp11 G A 5: 105,343,908 P8S probably damaging Het
Gfap A T 11: 102,893,137 M339K probably damaging Het
Gm14443 C T 2: 175,169,276 R459Q possibly damaging Het
Grip1 A G 10: 120,020,020 N632S probably benign Het
Hcar1 T G 5: 123,879,098 I177L possibly damaging Het
Hist1h4n G A 13: 21,832,041 R40W probably damaging Het
Ighv1-37 A G 12: 114,896,479 V37A probably damaging Het
Ilf3 T A 9: 21,399,804 F657L unknown Het
Ints2 T G 11: 86,233,226 T579P probably benign Het
Iqgap1 G T 7: 80,723,030 Y1520* probably null Het
Kdm4a T C 4: 118,143,918 H884R possibly damaging Het
Krtap19-1 A T 16: 88,869,244 Y52N unknown Het
Lama5 A T 2: 180,202,390 probably null Het
Med13l A G 5: 118,560,832 D16G possibly damaging Het
Mefv A G 16: 3,715,681 L242P probably damaging Het
Mob3c T C 4: 115,831,587 Y106H probably damaging Het
Nlrp1a A G 11: 71,123,857 I189T probably damaging Het
Nudt7 T C 8: 114,133,819 probably benign Het
Olfr1303 T A 2: 111,813,926 I267L probably benign Het
Olfr62 T C 4: 118,666,432 L305P probably benign Het
Pappa A G 4: 65,335,719 T1537A probably damaging Het
Pik3r4 T A 9: 105,650,591 V381E probably damaging Het
Pkd1 T A 17: 24,575,881 Y2181N probably damaging Het
Pmel G T 10: 128,716,484 V396F probably benign Het
Prdm9 A G 17: 15,544,997 I507T possibly damaging Het
Psme4 C T 11: 30,815,279 Q549* probably null Het
Ptprg T A 14: 11,962,657 W152R probably damaging Het
Ptprm A C 17: 66,693,566 V1141G probably damaging Het
Rapgef5 G A 12: 117,721,328 V505M probably damaging Het
Rnf213 T A 11: 119,435,051 M1558K Het
Slc35a1 A G 4: 34,675,034 V168A probably benign Het
Srebf1 T C 11: 60,205,867 T347A probably benign Het
Stard9 T A 2: 120,701,497 V2745D probably benign Het
Taar7e A T 10: 24,038,526 T305S probably benign Het
Tie1 T C 4: 118,479,877 S551G probably benign Het
Tmc5 T A 7: 118,623,597 Y173* probably null Het
Tns2 T A 15: 102,110,526 V384D probably damaging Het
Tubgcp4 T A 2: 121,184,409 Y267N probably damaging Het
Vmn1r53 A G 6: 90,223,718 V208A probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 T C 14: 32,974,234 D2784G Het
Zfp712 A C 13: 67,041,336 S376A probably benign Het
Znrf3 C T 11: 5,288,955 C232Y unknown Het
Other mutations in Lrrc72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lrrc72 APN 12 36221508 missense probably benign 0.01
IGL01573:Lrrc72 APN 12 36212562 splice site probably null
R1905:Lrrc72 UTSW 12 36208662 splice site probably null
R3754:Lrrc72 UTSW 12 36212568 missense probably benign 0.04
R4429:Lrrc72 UTSW 12 36208624 missense probably damaging 1.00
R6263:Lrrc72 UTSW 12 36208604 nonsense probably null
R6895:Lrrc72 UTSW 12 36209718 missense probably damaging 0.99
R7263:Lrrc72 UTSW 12 36208612 missense probably damaging 1.00
R7452:Lrrc72 UTSW 12 36212693 missense probably benign 0.11
R8217:Lrrc72 UTSW 12 36208677 missense probably damaging 1.00
V8831:Lrrc72 UTSW 12 36208657 missense possibly damaging 0.65
Z1177:Lrrc72 UTSW 12 36247693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCTTTGAAATTTTGAGCAAGACAC -3'
(R):5'- GGCTCAGCAATGCTCAGAAAAC -3'

Sequencing Primer
(F):5'- TTGAGCAAGACACATAGTAATGAAC -3'
(R):5'- CTGGTTAAAAACACTATCACGGG -3'
Posted On2019-10-07