Incidental Mutation 'R7410:Mefv'
ID575038
Institutional Source Beutler Lab
Gene Symbol Mefv
Ensembl Gene ENSMUSG00000022534
Gene NameMediterranean fever
SynonymsTRIM20, marenostrin, pyrin, FMF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7410 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location3707218-3718097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3715681 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 242 (L242P)
Ref Sequence ENSEMBL: ENSMUSP00000097795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]
Predicted Effect probably damaging
Transcript: ENSMUST00000023180
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534
AA Change: L242P

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 439 481 4.75e-11 SMART
low complexity region 490 503 N/A INTRINSIC
SCOP:d1f5qb1 519 616 8e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100222
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534
AA Change: L242P

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 469 511 4.75e-11 SMART
low complexity region 520 533 N/A INTRINSIC
SCOP:d1f5qb1 549 646 6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229725
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,244 S3P unknown Het
Adgrv1 A T 13: 81,563,619 D1079E probably benign Het
Agbl5 A T 5: 30,890,688 Y102F possibly damaging Het
Ankfy1 T C 11: 72,761,504 L1094S probably damaging Het
Ankrd42 A T 7: 92,610,554 V337E possibly damaging Het
Axl A G 7: 25,758,783 L849P probably benign Het
Bmpr2 T C 1: 59,868,493 I915T probably benign Het
Cables1 T A 18: 11,941,225 F494L probably benign Het
Cacna1e A C 1: 154,472,234 V927G probably benign Het
Cavin1 A T 11: 100,958,844 V320E probably damaging Het
Cemip T G 7: 83,952,834 S916R probably damaging Het
Cep57 G A 9: 13,818,684 probably benign Het
Ces1d T C 8: 93,192,805 N120D probably damaging Het
Cfap44 A T 16: 44,468,413 S1509C probably damaging Het
Chga A G 12: 102,562,607 D281G probably benign Het
Clstn2 A G 9: 97,541,867 F282L probably benign Het
Cnot1 A T 8: 95,733,159 V1855E possibly damaging Het
Cnr1 T A 4: 33,944,119 V169D probably damaging Het
Cpd T A 11: 76,782,308 H1337L probably damaging Het
Crabp2 T A 3: 87,952,278 D78E probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp2ab1 G A 16: 20,316,725 A9V probably benign Het
Cyp3a41b T C 5: 145,578,157 D86G probably damaging Het
Dner T A 1: 84,585,611 D96V probably damaging Het
Duox1 C A 2: 122,346,393 T1465N probably damaging Het
Ehd3 T A 17: 73,805,433 V64E probably benign Het
Ehmt1 A G 2: 24,848,068 V508A probably benign Het
Ephb3 G A 16: 21,221,408 V761I possibly damaging Het
Fam161b T C 12: 84,357,801 Q35R probably benign Het
Fam186a T A 15: 99,946,945 K473* probably null Het
Fam227b A T 2: 126,119,063 D215E probably damaging Het
Fkbp15 C A 4: 62,340,299 D144Y probably damaging Het
Galt T C 4: 41,757,707 I259T possibly damaging Het
Gbp11 G A 5: 105,343,908 P8S probably damaging Het
Gfap A T 11: 102,893,137 M339K probably damaging Het
Gm14443 C T 2: 175,169,276 R459Q possibly damaging Het
Grip1 A G 10: 120,020,020 N632S probably benign Het
Hcar1 T G 5: 123,879,098 I177L possibly damaging Het
Hist1h4n G A 13: 21,832,041 R40W probably damaging Het
Ighv1-37 A G 12: 114,896,479 V37A probably damaging Het
Ilf3 T A 9: 21,399,804 F657L unknown Het
Ints2 T G 11: 86,233,226 T579P probably benign Het
Iqgap1 G T 7: 80,723,030 Y1520* probably null Het
Kdm4a T C 4: 118,143,918 H884R possibly damaging Het
Krtap19-1 A T 16: 88,869,244 Y52N unknown Het
Lama5 A T 2: 180,202,390 probably null Het
Lrrc72 T C 12: 36,222,804 N89D probably damaging Het
Med13l A G 5: 118,560,832 D16G possibly damaging Het
Mob3c T C 4: 115,831,587 Y106H probably damaging Het
Nlrp1a A G 11: 71,123,857 I189T probably damaging Het
Nudt7 T C 8: 114,133,819 probably benign Het
Olfr1303 T A 2: 111,813,926 I267L probably benign Het
Olfr62 T C 4: 118,666,432 L305P probably benign Het
Pappa A G 4: 65,335,719 T1537A probably damaging Het
Pik3r4 T A 9: 105,650,591 V381E probably damaging Het
Pkd1 T A 17: 24,575,881 Y2181N probably damaging Het
Pmel G T 10: 128,716,484 V396F probably benign Het
Prdm9 A G 17: 15,544,997 I507T possibly damaging Het
Psme4 C T 11: 30,815,279 Q549* probably null Het
Ptprg T A 14: 11,962,657 W152R probably damaging Het
Ptprm A C 17: 66,693,566 V1141G probably damaging Het
Rapgef5 G A 12: 117,721,328 V505M probably damaging Het
Rnf213 T A 11: 119,435,051 M1558K Het
Slc35a1 A G 4: 34,675,034 V168A probably benign Het
Srebf1 T C 11: 60,205,867 T347A probably benign Het
Stard9 T A 2: 120,701,497 V2745D probably benign Het
Taar7e A T 10: 24,038,526 T305S probably benign Het
Tie1 T C 4: 118,479,877 S551G probably benign Het
Tmc5 T A 7: 118,623,597 Y173* probably null Het
Tns2 T A 15: 102,110,526 V384D probably damaging Het
Tubgcp4 T A 2: 121,184,409 Y267N probably damaging Het
Vmn1r53 A G 6: 90,223,718 V208A probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 T C 14: 32,974,234 D2784G Het
Zfp712 A C 13: 67,041,336 S376A probably benign Het
Znrf3 C T 11: 5,288,955 C232Y unknown Het
Other mutations in Mefv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mefv APN 16 3710960 missense probably benign 0.01
IGL00583:Mefv APN 16 3716072 nonsense probably null
IGL00963:Mefv APN 16 3715720 missense possibly damaging 0.83
IGL02185:Mefv APN 16 3715850 missense probably benign 0.09
IGL02500:Mefv APN 16 3713577 missense probably damaging 1.00
R0158:Mefv UTSW 16 3715456 missense possibly damaging 0.67
R1312:Mefv UTSW 16 3708534 splice site probably benign
R1793:Mefv UTSW 16 3708664 missense possibly damaging 0.53
R1956:Mefv UTSW 16 3717827 missense probably damaging 1.00
R2169:Mefv UTSW 16 3710888 missense probably benign 0.24
R2973:Mefv UTSW 16 3715694 nonsense probably null
R3723:Mefv UTSW 16 3708194 critical splice donor site probably null
R3724:Mefv UTSW 16 3708194 critical splice donor site probably null
R3953:Mefv UTSW 16 3715400 missense possibly damaging 0.60
R4276:Mefv UTSW 16 3715569 missense probably benign 0.41
R4650:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4651:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4652:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4670:Mefv UTSW 16 3708207 missense possibly damaging 0.67
R4781:Mefv UTSW 16 3715334 missense probably benign 0.00
R5593:Mefv UTSW 16 3715451 missense probably benign 0.00
R5834:Mefv UTSW 16 3716046 missense probably damaging 0.97
R5867:Mefv UTSW 16 3715933 missense probably damaging 1.00
R5954:Mefv UTSW 16 3715715 missense probably benign 0.09
R6056:Mefv UTSW 16 3708042 missense possibly damaging 0.73
R6260:Mefv UTSW 16 3713034 missense probably benign 0.03
R6409:Mefv UTSW 16 3710793 critical splice donor site probably null
R6511:Mefv UTSW 16 3715946 missense probably benign 0.00
R6666:Mefv UTSW 16 3707998 missense possibly damaging 0.88
R6952:Mefv UTSW 16 3710880 missense probably damaging 1.00
R7259:Mefv UTSW 16 3713053 missense probably damaging 1.00
R7444:Mefv UTSW 16 3715522 missense probably benign 0.21
X0064:Mefv UTSW 16 3710841 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCCCCAATCAACGATGTTTTGG -3'
(R):5'- TATAGGAGAACCCAGGGCAC -3'

Sequencing Primer
(F):5'- CCCAATCAACGATGTTTTGGAAGAC -3'
(R):5'- CACCCAGTCCCCAGGGG -3'
Posted On2019-10-07