Mutagenetix > Incidental Mutation

Incidental Mutation 'R7411:Abcb11'

575053

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

045492-MU

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Essential gene?

Possibly essential (E-score: 0.608) question?

Stock #

R7411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 69303936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably null
Transcript: ENSMUST00000102709

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102710

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000180142

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	C	T	19: 3,717,241	T276I	possibly damaging	Het
9130011E15Rik	A	C	19: 45,965,435	V170G	probably benign	Het
Abca17	A	G	17: 24,328,569	I277T	possibly damaging	Het
Abcc12	C	A	8: 86,560,850	R122L	possibly damaging	Het
Abcc8	A	G	7: 46,165,917		probably null	Het
Adam28	C	T	14: 68,626,947	R469K	probably damaging	Het
Adamts18	T	C	8: 113,777,730	Y243C	probably damaging	Het
Agbl3	T	C	6: 34,814,819	S619P	probably damaging	Het
Alpk3	A	T	7: 81,092,852	T806S	probably benign	Het
Atoh1	T	A	6: 64,729,930	I203N	probably damaging	Het
Cables1	A	G	18: 11,840,515	E237G	probably benign	Het
Cacna1d	A	G	14: 30,352,990	M1T	probably null	Het
Ccdc91	C	T	6: 147,592,198	Q363*	probably null	Het
Ceacam5	T	A	7: 17,750,753	D473E	probably damaging	Het
Cfap54	T	A	10: 92,868,755	D2821V	unknown	Het
Clca3a2	A	G	3: 144,802,099	S737P	probably damaging	Het
Clec4n	T	A	6: 123,232,186	M70K	probably benign	Het
Dstyk	G	A	1: 132,417,666	G21S	probably benign	Het
Enpp5	A	G	17: 44,081,475	D265G	probably damaging	Het
Gabrb1	T	C	5: 72,122,195		probably null	Het
Gm11639	T	G	11: 104,999,723	N4210K	probably benign	Het
Gm28710	A	T	5: 16,824,765	T500S	possibly damaging	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gm5861	T	A	5: 11,183,149		probably null	Het
Gm9513	T	C	9: 36,475,684	V16A	possibly damaging	Het
Guk1	A	G	11: 59,185,985	F91L		Het
Ints1	C	T	5: 139,764,260	E961K	possibly damaging	Het
Irx2	T	A	13: 72,629,063	M1K	probably null	Het
Jrk	C	T	15: 74,707,199	R79H	possibly damaging	Het
Kcnu1	G	T	8: 25,892,088	V489L	probably damaging	Het
Kctd7	C	T	5: 130,152,424	T209M	probably benign	Het
Kdm5a	T	A	6: 120,426,815	V1127E	probably damaging	Het
Klk6	A	G	7: 43,826,943	H69R	probably damaging	Het
Lck	T	C	4: 129,551,970	K340R	probably benign	Het
Lrrc75a	A	G	11: 62,605,908	L276P	probably damaging	Het
Med25	A	G	7: 44,878,243	W730R	probably damaging	Het
Muc4	T	C	16: 32,751,322	V400A	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myt1	C	A	2: 181,815,106	H906Q	probably damaging	Het
Ncl	A	T	1: 86,350,842	F673I	probably damaging	Het
Nfe2l1	G	T	11: 96,822,183	T216N	probably benign	Het
Nos2	G	A	11: 78,944,855		probably null	Het
Nphp4	T	A	4: 152,554,717	I935N	probably benign	Het
Ntn1	G	A	11: 68,386,089	A11V	probably benign	Het
Olfr1257	T	C	2: 89,881,261	V145A	probably damaging	Het
Olfr1395	A	T	11: 49,148,994	M246L	probably benign	Het
Pcdha12	A	G	18: 37,021,608	Y460C	probably damaging	Het
Pcdha4	G	T	18: 36,953,058	R98L	probably benign	Het
Pitpnc1	A	G	11: 107,212,572	S234P	probably damaging	Het
Pmfbp1	A	T	8: 109,513,871	Y195F	probably damaging	Het
Prl6a1	T	C	13: 27,318,142	I164T	probably damaging	Het
Ptpn18	G	A	1: 34,472,192		probably null	Het
Rhbdl2	G	A	4: 123,829,642	A280T	possibly damaging	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Sema3a	T	G	5: 13,516,263	Y171*	probably null	Het
Set	A	G	2: 30,066,885	E22G	probably benign	Het
Sirpb1b	A	T	3: 15,542,997	D229E	probably benign	Het
Slc12a2	A	T	18: 57,941,013	I1096F	probably benign	Het
Slc30a5	T	C	13: 100,818,180	I159V	probably benign	Het
Slc35f3	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8: 126,389,038		probably benign	Het
Slc6a20b	A	G	9: 123,604,948	I275T	probably benign	Het
Stradb	A	C	1: 58,988,518	D69A	possibly damaging	Het
Supt16	A	T	14: 52,178,051	V409E	probably damaging	Het
Tcea2	A	G	2: 181,686,664	N195S	probably damaging	Het
Thumpd3	T	C	6: 113,056,111	V270A	possibly damaging	Het
Urgcp	T	A	11: 5,718,116	H117L	probably benign	Het
Vps13c	T	A	9: 67,972,001	M3408K	probably damaging	Het
Wdfy4	A	C	14: 33,106,131	M1078R		Het
Wdr63	A	G	3: 146,097,145	V97A	probably damaging	Het
Ypel5	G	A	17: 72,846,444		probably null	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69239169	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACATCGTTATGCACATGCTG -3'
(R):5'- GAATTCAGTCGTATTGATCTACACCTC -3'

Sequencing Primer
(F):5'- GCTGTGGGTCATTATTTAATACTGAG -3'
(R):5'- CTGTCGACAGCTTTGTCT -3'

Posted On

2019-10-07