Incidental Mutation 'R7411:Tcea2'
ID575055
Institutional Source Beutler Lab
Gene Symbol Tcea2
Ensembl Gene ENSMUSG00000059540
Gene Nametranscription elongation factor A (SII), 2
SynonymsSII-T1, Tceat, S-II-T1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181680310-181688071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181686664 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 195 (N195S)
Ref Sequence ENSEMBL: ENSMUSP00000099331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000103042] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108778] [ENSMUST00000108779] [ENSMUST00000129745] [ENSMUST00000165416]
Predicted Effect probably benign
Transcript: ENSMUST00000002532
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103042
AA Change: N195S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099331
Gene: ENSMUSG00000059540
AA Change: N195S

DomainStartEndE-ValueType
TFS2N 7 81 2.51e-25 SMART
low complexity region 114 129 N/A INTRINSIC
TFS2M 136 237 4.14e-51 SMART
ZnF_C2C2 259 298 7.37e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108769
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108776
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108778
SMART Domains Protein: ENSMUSP00000104408
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
RGS 117 233 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129006
AA Change: N192S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120083
Gene: ENSMUSG00000059540
AA Change: N192S

DomainStartEndE-ValueType
Pfam:Med26 27 77 5.1e-17 PFAM
low complexity region 112 127 N/A INTRINSIC
TFS2M 134 235 4.14e-51 SMART
ZnF_C2C2 257 296 7.37e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129745
AA Change: N188S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119646
Gene: ENSMUSG00000059540
AA Change: N188S

DomainStartEndE-ValueType
Pfam:Med26 21 73 2.1e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
TFS2M 129 230 4.14e-51 SMART
ZnF_C2C2 252 291 7.37e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144476
SMART Domains Protein: ENSMUSP00000120723
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
Pfam:RGS 1 49 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165416
SMART Domains Protein: ENSMUSP00000129026
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Tcea2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Tcea2 APN 2 181685835 missense probably benign 0.02
R0009:Tcea2 UTSW 2 181685817 missense probably benign
R0513:Tcea2 UTSW 2 181684481 missense probably benign 0.19
R0626:Tcea2 UTSW 2 181687638 missense probably damaging 1.00
R1228:Tcea2 UTSW 2 181684445 missense probably benign 0.11
R1540:Tcea2 UTSW 2 181686958 missense possibly damaging 0.55
R2095:Tcea2 UTSW 2 181686932 missense probably damaging 1.00
R4735:Tcea2 UTSW 2 181686721 missense probably damaging 1.00
R5499:Tcea2 UTSW 2 181680434 missense probably damaging 0.99
R7039:Tcea2 UTSW 2 181686918 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTGGGTAGATTCATCTCCATG -3'
(R):5'- AGTCTGTGTGCCACCTGTAC -3'

Sequencing Primer
(F):5'- ATTCATCTCCATGAGCCTGGGAAG -3'
(R):5'- AGTCATGGCCTTGCGAATC -3'
Posted On2019-10-07