Incidental Mutation 'R7411:Clca3a2'
ID 575058
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144802099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 737 (S737P)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably damaging
Transcript: ENSMUST00000029929
AA Change: S737P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: S737P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000199029
AA Change: S128P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262
AA Change: S128P

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 probably benign Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144813686 splice site probably benign
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
R9569:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144797814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGGTAAAGGGGTGTCTTTC -3'
(R):5'- AGTGTCTGCTGTCAATTTACCTGAG -3'

Sequencing Primer
(F):5'- AGGTAAAGGGGTGTCTTTCATAAC -3'
(R):5'- GTCAATTTACCTGAGCCCTGAG -3'
Posted On 2019-10-07